WNK1

Gene symbol:	WNK1
Gene:	65125
Uniprot Function:	Serine/threonine kinase which plays an important role in the regulation of electrolyte homeostasis, cell signaling, survival, and proliferation. Acts as an activator and inhibitor of sodium-coupled chloride cotransporters and potassium-coupled chloride cotransporters respectively. Activates SCNN1A, SCNN1B, SCNN1D and SGK1. Controls sodium and chloride ion transport by inhibiting the activity of WNK4, by either phosphorylating the kinase or via an interaction between WNK4 and the autoinhibitory domain of WNK1. WNK4 regulates the activity of the thiazide-sensitive Na-Cl cotransporter, SLC12A3, by phosphorylation. WNK1 may also play a role in actin cytoskeletal reorganization. Phosphorylates NEDD4L. Acts as a scaffold to inhibit SLC4A4, SLC26A6 as well as CFTR activities and surface expression, recruits STK39 which mediates the inhibition (By similarity).
Mitotic Index	0.0294
Interphase Cluster:	#220 (6 genes)
Mitotic Cluster:	#191 (13 genes)
sgRNA 1:	ATTCTACAGGCACAGTCCCA (interphase cells: 2107, mitotic cells: 54)
sgRNA 2:	GCCGTGGGAATGTCTAACGA (interphase cells: 635, mitotic cells: 26)
sgRNA 3:	GCTGATGGGACGGTTGACAG (interphase cells: 1176, mitotic cells: 52)
sgRNA 4:	TGTGGGGACTTGAAGTGACG (interphase cells: 1070, mitotic cells: 19)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	-1.623e-01	5316 of 5322	5.407e-04
Nucleus	DNA	Mean	-1.125e-01	4726 of 5322	0.008
Nucleus	gH2AX	Mean	-1.278e-01	5255 of 5322	8.823e-04
Nucleus	DNA - gH2AX	Correlation	-1.611e-01	4866 of 5322	1.021e-04
Nucleus	Shape	Area	-5.336e-02	4507 of 5322	0.217
Nucleus	Shape	Eccentricity	0.103	186 of 5322	0.006
Nucleus	Shape	Form Factor	-1.916e-01	5169 of 5322	2.872e-04
Nucleus	Shape	Solidity	-2.766e-01	5271 of 5322	1.903e-04
Cell	DNA	Mass Displacement	0.102	208 of 5322	0.019
Cell	Tubulin	Mean	-2.481e-01	5221 of 5322	2.141e-04
Cell	Tubulin	Mass Displacement	-1.995e-01	5292 of 5322	3.984e-04
Cell	Actin	Mean	-1.668e-01	5162 of 5322	1.723e-04
Cell	Tubulin - Actin	Correlation	0.100	576 of 5322	0.015
Cell	DNA - Tubulin	Correlation	0.050	1908 of 5322	0.210
Cell	Shape	Area	-1.397e-01	4910 of 5322	1.651e-04
Cell	Shape	Eccentricity	0.086	98 of 5322	0.077
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.320	460 of 5322	0.592
Nucleus	DNA	Mean	0.524	31 of 5322	0.615
Nucleus	DNA	Mass Displacement	0.197	777 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.383	92 of 5322	1.000
Nucleus	gH2AX	Mean	0.216	662 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	-4.908e-01	5309 of 5322	0.707
Nucleus	Tubulin	Mean Frac 0	-1.172e-01	4791 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.252	485 of 5322	0.953
Nucleus	Tubulin	Std Edge	0.108	1177 of 5322	0.999
Nucleus	Shape	Area	-4.168e-02	4385 of 5322	0.990
Nucleus	Shape	Eccentricity	0.372	23 of 5322	0.562
Nucleus	Shape	Form Factor	-2.362e-01	4436 of 5322	0.976
Cell	Tubulin	Mean	0.087	2230 of 5322	0.997
Cell	Tubulin	Mean Frac 3	-3.092e-01	4754 of 5322	0.941
Cell	Actin	Mean	0.167	1132 of 5322	0.997
Cell	Shape	Area	-2.980e-02	4249 of 5322	0.998

MIT Central Accessability