VPS29

Gene symbol:	VPS29
Gene:	51699
Uniprot Function:	Acts as component of the retromer cargo-selective complex (CSC). The CSC is believed to be the core functional component of retromer or respective retromer complex variants acting to prevent missorting of selected transmembrane cargo proteins into the lysosomal degradation pathway. The recruitment of the CSC to the endosomal membrane involves RAB7A and SNX3. The SNX-BAR retromer mediates retrograde transport of cargo proteins from endosomes to the trans-Golgi network (TGN) and is involved in endosome-to-plasma membrane transport for cargo protein recycling. The SNX3-retromer mediates the retrograde endosome-to-TGN transport of WLS distinct from the SNX-BAR retromer pathway. The SNX27-retromer is believed to be involved in endosome-to-plasma membrane trafficking and recycling of a broad spectrum of cargo proteins. The CSC seems to act as recruitment hub for other proteins, such as the WASH complex and TBC1D5. Required to regulate transcytosis of the polymeric immunoglobulin receptor (pIgR-pIgA) (PubMed:15247922, PubMed:21725319, PubMed:23563491). Acts also as component of the retriever complex. The retriever complex is a heterotrimeric complex related to retromer cargo-selective complex (CSC) and essential for retromer-independent retrieval and recycling of numerous cargos such as integrin alpha-5/beta-1 (ITGA5:ITGB1) (PubMed:28892079). In the endosomes, retriever complex drives the retrieval and recycling of NxxY-motif-containing cargo proteins by coupling to SNX17, a cargo essential for the homeostatic maintenance of numerous cell surface proteins associated with processes that include cell migration, cell adhesion, nutrient supply and cell signaling (PubMed:28892079). The recruitment of the retriever complex to the endosomal membrane involves CCC and WASH complexes (PubMed:28892079). Involved in GLUT1 endosome-to-plasma membrane trafficking; the function is dependent of association with ANKRD27 (PubMed:24856514).
Mitotic Index	0.0235
Interphase Cluster:	#75 (29 genes)
Mitotic Cluster:	#116 (23 genes)
sgRNA 1:	ATCAAATTGCCTCTGCAACA (interphase cells: 2749, mitotic cells: 55)
sgRNA 2:	GGACATCAAGTTATTCCATG (interphase cells: 2060, mitotic cells: 52)
sgRNA 3:	GGCAAACTGTTGCACCGGTG (interphase cells: 592, mitotic cells: 20)
sgRNA 4:	TTATGACTATCTCAAGACTC (interphase cells: 1300, mitotic cells: 34)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	-2.516e-02	4230 of 5322	0.681
Nucleus	DNA	Mean	-2.666e-02	2860 of 5322	0.608
Nucleus	gH2AX	Mean	-1.004e-02	4746 of 5322	0.771
Nucleus	DNA - gH2AX	Correlation	-2.207e-02	1461 of 5322	0.437
Nucleus	Shape	Area	-8.280e-03	3575 of 5322	0.814
Nucleus	Shape	Eccentricity	-8.529e-04	3410 of 5322	0.981
Nucleus	Shape	Form Factor	0.003	566 of 5322	0.843
Nucleus	Shape	Solidity	-1.762e-02	1212 of 5322	0.652
Cell	DNA	Mass Displacement	0.032	2159 of 5322	0.623
Cell	Tubulin	Mean	-4.621e-02	4230 of 5322	0.343
Cell	Tubulin	Mass Displacement	0.025	1521 of 5322	0.669
Cell	Actin	Mean	-2.020e-02	3637 of 5322	0.769
Cell	Tubulin - Actin	Correlation	-5.947e-02	5100 of 5322	0.130
Cell	DNA - Tubulin	Correlation	0.011	3410 of 5322	0.842
Cell	Shape	Area	0.003	3138 of 5322	0.953
Cell	Shape	Eccentricity	0.038	1003 of 5322	0.537
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.074	2856 of 5322	0.973
Nucleus	DNA	Mean	0.018	2625 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.079	2244 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.015	2894 of 5322	1.000
Nucleus	gH2AX	Mean	0.023	2622 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.109	885 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.050	2743 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.232	580 of 5322	0.969
Nucleus	Tubulin	Std Edge	0.223	364 of 5322	0.999
Nucleus	Shape	Area	-1.196e-02	4072 of 5322	0.990
Nucleus	Shape	Eccentricity	-1.147e-01	3762 of 5322	1.000
Nucleus	Shape	Form Factor	0.049	806 of 5322	0.998
Cell	Tubulin	Mean	0.045	2879 of 5322	0.997
Cell	Tubulin	Mean Frac 3	-1.051e-01	2992 of 5322	0.999
Cell	Actin	Mean	0.151	1285 of 5322	0.997
Cell	Shape	Area	0.055	3220 of 5322	0.998

MIT Central Accessability