SOX10

Due to sgRNA sequence design constraints two or more of the sgRNAs used to target this gene have multiple genomic target sites, potentially impacting the observed phenotype through increased DNA damage.

Gene symbol:	SOX10
Gene:	6663
Uniprot Function:	Transcription factor that plays a central role in developing and mature glia (By similarity). Specifically activates expression of myelin genes, during oligodendrocyte (OL) maturation, such as DUSP15 and MYRF, thereby playing a central role in oligodendrocyte maturation and CNS myelination (By similarity). Once induced, MYRF cooperates with SOX10 to implement the myelination program (By similarity). Transcriptional activator of MITF, acting synergistically with PAX3 (PubMed:21965087). Transcriptional activator of MBP, via binding to the gene promoter (By similarity).
Mitotic Index	0.0253
Interphase Cluster:	#221 (4 genes)
Mitotic Cluster:	#91 (25 genes)
sgRNA 1:	CAGCGGCTACGACTGGACGC (interphase cells: 1441, mitotic cells: 35)
sgRNA 2:	CCATGTTGGACATTACCTCG (interphase cells: 1429, mitotic cells: 35)
sgRNA 3:	GGTCAGAGTAGTCAAACTGG (interphase cells: 1814, mitotic cells: 46)
sgRNA 4:	GTAGTGGGCCTGGATGGCGG (interphase cells: 447, mitotic cells: 17)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	-5.224e-02	4911 of 5322	0.314
Nucleus	DNA	Mean	-7.773e-02	4245 of 5322	0.074
Nucleus	gH2AX	Mean	0.067	2969 of 5322	0.103
Nucleus	DNA - gH2AX	Correlation	-1.748e-01	4976 of 5322	1.021e-04
Nucleus	Shape	Area	-6.004e-02	4574 of 5322	0.165
Nucleus	Shape	Eccentricity	0.074	432 of 5322	0.057
Nucleus	Shape	Form Factor	-7.565e-02	3757 of 5322	0.068
Nucleus	Shape	Solidity	-7.672e-02	3712 of 5322	0.032
Cell	DNA	Mass Displacement	0.019	3095 of 5322	0.819
Cell	Tubulin	Mean	0.067	823 of 5322	0.122
Cell	Tubulin	Mass Displacement	0.015	2099 of 5322	0.850
Cell	Actin	Mean	-3.565e-02	4051 of 5322	0.548
Cell	Tubulin - Actin	Correlation	0.015	2947 of 5322	0.796
Cell	DNA - Tubulin	Correlation	0.019	3058 of 5322	0.708
Cell	Shape	Area	-4.786e-02	4342 of 5322	0.296
Cell	Shape	Eccentricity	0.040	911 of 5322	0.549
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.232	974 of 5322	0.906
Nucleus	DNA	Mean	0.136	1065 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.009	3376 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.133	1167 of 5322	1.000
Nucleus	gH2AX	Mean	0.017	2720 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.068	1302 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	-7.348e-04	3519 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.272	407 of 5322	0.996
Nucleus	Tubulin	Std Edge	0.154	750 of 5322	0.999
Nucleus	Shape	Area	0.107	2561 of 5322	0.990
Nucleus	Shape	Eccentricity	0.141	525 of 5322	1.000
Nucleus	Shape	Form Factor	-3.691e-01	5032 of 5322	0.976
Cell	Tubulin	Mean	0.271	545 of 5322	0.997
Cell	Tubulin	Mean Frac 3	-1.754e-01	3815 of 5322	0.999
Cell	Actin	Mean	0.029	2813 of 5322	0.998
Cell	Shape	Area	0.170	1720 of 5322	0.998

MIT Central Accessability