SCAP

Gene symbol:	SCAP
Gene:	22937
Uniprot Function:	Escort protein required for cholesterol as well as lipid homeostasis (By similarity). Regulates export of the SCAP-SREBP complex from the endoplasmic reticulum to the Golgi upon low cholesterol, thereby regulating the processing of sterol regulatory element-binding proteins (SREBPs) SREBF1/SREBP1 and SREBF2/SREBP2 (By similarity). At high sterol concentrations, formation of a ternary complex with INSIG (INSIG1 or INSIG2) leads to mask the ER export signal in SCAP, promoting retention of the complex in the endoplasmic reticulum (By similarity). Low sterol concentrations trigger release of INSIG, a conformational change in the SSD domain of SCAP, unmasking of the ER export signal, promoting recruitment into COPII-coated vesicles and transport of the SCAP-SREBP to the Golgi: in the Golgi, SREBPs are then processed, releasing the transcription factor fragment of SREBPs from the membrane, its import into the nucleus and up-regulation of LDLR, INSIG1 and the mevalonate pathway (By similarity). Binds cholesterol via its SSD domain (By similarity).
Mitotic Index	0.0291
Interphase Cluster:	#104 (23 genes)
Mitotic Cluster:	#25 (36 genes)
sgRNA 1:	CAGGATGCCAATCCAGACAA (interphase cells: 1623, mitotic cells: 56)
sgRNA 2:	CTGCTGGACATAAGCCACCG (interphase cells: 1370, mitotic cells: 37)
sgRNA 3:	GCCCACCCTCAATGGCGGGT (interphase cells: 1122, mitotic cells: 36)
sgRNA 4:	GGTCCACGTGCACTTCAAGG (interphase cells: 1587, mitotic cells: 42)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.007	2754 of 5322	0.964
Nucleus	DNA	Mean	0.085	562 of 5322	0.029
Nucleus	gH2AX	Mean	0.116	1577 of 5322	0.005
Nucleus	DNA - gH2AX	Correlation	0.061	300 of 5322	0.069
Nucleus	Shape	Area	-7.183e-02	4679 of 5322	0.073
Nucleus	Shape	Eccentricity	-1.223e-01	5167 of 5322	4.529e-04
Nucleus	Shape	Form Factor	-2.437e-02	1476 of 5322	0.600
Nucleus	Shape	Solidity	-4.192e-02	2334 of 5322	0.228
Cell	DNA	Mass Displacement	0.058	828 of 5322	0.244
Cell	Tubulin	Mean	-2.815e-02	3783 of 5322	0.619
Cell	Tubulin	Mass Displacement	0.005	2693 of 5322	0.950
Cell	Actin	Mean	-8.079e-02	4775 of 5322	0.070
Cell	Tubulin - Actin	Correlation	0.015	2930 of 5322	0.775
Cell	DNA - Tubulin	Correlation	-1.885e-01	5289 of 5322	1.948e-04
Cell	Shape	Area	0.051	1490 of 5322	0.463
Cell	Shape	Eccentricity	0.034	1211 of 5322	0.600
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.091	2621 of 5322	0.965
Nucleus	DNA	Mean	0.066	1948 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.057	2588 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.100	1583 of 5322	1.000
Nucleus	gH2AX	Mean	0.259	474 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.016	2029 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.315	294 of 5322	0.904
Nucleus	Tubulin	Mean Edge	0.108	1750 of 5322	0.999
Nucleus	Tubulin	Std Edge	-1.314e-01	4181 of 5322	0.999
Nucleus	Shape	Area	0.393	468 of 5322	0.274
Nucleus	Shape	Eccentricity	-3.101e-01	4988 of 5322	1.000
Nucleus	Shape	Form Factor	0.083	510 of 5322	0.998
Cell	Tubulin	Mean	0.238	720 of 5322	0.944
Cell	Tubulin	Mean Frac 3	-1.983e-01	4054 of 5322	0.999
Cell	Actin	Mean	0.094	1977 of 5322	0.997
Cell	Shape	Area	0.274	800 of 5322	0.917

MIT Central Accessability