POLR3H

Gene symbol:	POLR3H
Gene:	171568
Uniprot Function:	DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Specific peripheric component of RNA polymerase III which synthesizes small RNAs, such as 5S rRNA and tRNAs. Plays a key role in sensing and limiting infection by intracellular bacteria and DNA viruses. Acts as nuclear and cytosolic DNA sensor involved in innate immune response. Can sense non-self dsDNA that serves as template for transcription into dsRNA. The non-self RNA polymerase III transcripts, such as Epstein-Barr virus-encoded RNAs (EBERs) induce type I interferon and NF- Kappa-B through the RIG-I pathway (By similarity).
Mitotic Index	0.0278
Interphase Cluster:	#221 (4 genes)
Mitotic Cluster:	#30 (33 genes)
sgRNA 1:	ATGCAGGTCGTGTACAACGT (interphase cells: 1175, mitotic cells: 24)
sgRNA 2:	GCCATCCCCAGGGAATACAT (interphase cells: 1196, mitotic cells: 25)
sgRNA 3:	GCTCAACGACTCCATTGCCG (interphase cells: 172, mitotic cells: 5)
sgRNA 4:	TCCTCTCAAACTGCCAAGGG (interphase cells: 2598, mitotic cells: 93)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	-8.792e-02	5208 of 5322	0.058
Nucleus	DNA	Mean	-3.102e-03	2075 of 5322	0.992
Nucleus	gH2AX	Mean	-1.457e-02	4805 of 5322	0.715
Nucleus	DNA - gH2AX	Correlation	-1.517e-01	4782 of 5322	1.021e-04
Nucleus	Shape	Area	-7.748e-02	4720 of 5322	0.092
Nucleus	Shape	Eccentricity	0.085	316 of 5322	0.047
Nucleus	Shape	Form Factor	-5.124e-02	2741 of 5322	0.273
Nucleus	Shape	Solidity	-9.257e-02	4144 of 5322	0.018
Cell	DNA	Mass Displacement	0.003	4187 of 5322	0.999
Cell	Tubulin	Mean	0.010	2387 of 5322	0.855
Cell	Tubulin	Mass Displacement	0.043	766 of 5322	0.457
Cell	Actin	Mean	-1.250e-01	5051 of 5322	0.008
Cell	Tubulin - Actin	Correlation	0.068	970 of 5322	0.136
Cell	DNA - Tubulin	Correlation	0.022	2960 of 5322	0.687
Cell	Shape	Area	-9.882e-02	4789 of 5322	0.030
Cell	Shape	Eccentricity	-1.314e-02	4500 of 5322	0.933
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.179	1477 of 5322	0.927
Nucleus	DNA	Mean	0.066	1935 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.042	2828 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.199	619 of 5322	1.000
Nucleus	gH2AX	Mean	-4.787e-02	3618 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	-3.011e-01	5177 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	-8.763e-02	4582 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.205	774 of 5322	0.996
Nucleus	Tubulin	Std Edge	0.017	2318 of 5322	0.999
Nucleus	Shape	Area	0.075	2992 of 5322	0.990
Nucleus	Shape	Eccentricity	0.028	1663 of 5322	1.000
Nucleus	Shape	Form Factor	0.064	658 of 5322	0.998
Cell	Tubulin	Mean	0.035	3021 of 5322	0.998
Cell	Tubulin	Mean Frac 3	0.038	1269 of 5322	0.999
Cell	Actin	Mean	-9.064e-02	4310 of 5322	0.997
Cell	Shape	Area	0.067	3054 of 5322	0.998

MIT Central Accessability