PELO

Due to sgRNA sequence design constraints two or more of the sgRNAs used to target this gene have multiple genomic target sites, potentially impacting the observed phenotype through increased DNA damage.

Gene symbol:	PELO
Gene:	53918
Uniprot Function:	Cotranslational quality control factor involved in the No-Go Decay (NGD) pathway (PubMed:21448132, PubMed:29861391). In the presence of ABCE1 and HBS1L, is required for 48S complex formation from 80S ribosomes and dissociation of vacant 80S ribosomes (PubMed:21448132). Together with HBS1L and in presence of ABCE1, recognizes stalled ribosomes and promotes dissociation of elongation complexes assembled on non-stop mRNAs; this triggers endonucleolytic cleavage of the mRNA, a mechanism to release non-functional ribosomes and to degrade damaged mRNAs as part of the No-Go Decay (NGD) pathway (PubMed:21448132). As part of the PINK1-regulated signaling, upon mitochondrial damage is recruited to the ribosome/mRNA-ribonucleoprotein complex associated to mitochondrial outer membrane thereby enabling the recruitment of autophagy receptors and induction of mitophagy (PubMed:29861391).
Mitotic Index	0.027000000000000003
Interphase Cluster:	#112 (22 genes)
Mitotic Cluster:	#146 (19 genes)
sgRNA 1:	ACTGCTCCCTCACAAATCCT (interphase cells: 2685, mitotic cells: 80)
sgRNA 2:	AGAATGAGTATGTCAAGATG (interphase cells: 3235, mitotic cells: 98)
sgRNA 3:	GGCTTGAGAGTCGAAGTCGA (interphase cells: 1162, mitotic cells: 20)
sgRNA 4:	TGACTAAGCAGATATGGGCG (interphase cells: 2162, mitotic cells: 59)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	-5.607e-02	4962 of 5322	0.183
Nucleus	DNA	Mean	0.069	651 of 5322	0.064
Nucleus	gH2AX	Mean	0.091	2191 of 5322	0.018
Nucleus	DNA - gH2AX	Correlation	-5.273e-03	1051 of 5322	0.802
Nucleus	Shape	Area	-1.039e-01	4851 of 5322	0.002
Nucleus	Shape	Eccentricity	-2.346e-02	4321 of 5322	0.617
Nucleus	Shape	Form Factor	-2.411e-02	1460 of 5322	0.562
Nucleus	Shape	Solidity	-4.933e-02	2668 of 5322	0.116
Cell	DNA	Mass Displacement	0.016	3336 of 5322	0.818
Cell	Tubulin	Mean	-9.368e-02	4862 of 5322	0.022
Cell	Tubulin	Mass Displacement	0.010	2408 of 5322	0.884
Cell	Actin	Mean	0.027	2140 of 5322	0.604
Cell	Tubulin - Actin	Correlation	0.045	1607 of 5322	0.229
Cell	DNA - Tubulin	Correlation	-2.072e-03	3907 of 5322	0.958
Cell	Shape	Area	-6.524e-02	4575 of 5322	0.089
Cell	Shape	Eccentricity	0.010	2936 of 5322	0.913
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.089	2642 of 5322	0.965
Nucleus	DNA	Mean	0.087	1641 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.232	541 of 5322	0.999
Nucleus	DNA	Mean Frac 3	-1.262e-01	4654 of 5322	1.000
Nucleus	gH2AX	Mean	-1.195e-02	3108 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.120	790 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	-1.189e-02	3680 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.148	1289 of 5322	0.996
Nucleus	Tubulin	Std Edge	-2.746e-02	2937 of 5322	0.999
Nucleus	Shape	Area	0.099	2685 of 5322	0.989
Nucleus	Shape	Eccentricity	-7.180e-02	3196 of 5322	1.000
Nucleus	Shape	Form Factor	-5.701e-02	2234 of 5322	0.998
Cell	Tubulin	Mean	-8.988e-03	3626 of 5322	1.000
Cell	Tubulin	Mean Frac 3	0.087	816 of 5322	0.999
Cell	Actin	Mean	0.083	2104 of 5322	0.997
Cell	Shape	Area	0.184	1568 of 5322	0.994

MIT Central Accessability