MYOC

Gene symbol:	MYOC
Gene:	4653
Uniprot Function:	Secreted glycoprotein regulating the activation of different signaling pathways in adjacent cells to control different processes including cell adhesion, cell-matrix adhesion, cytoskeleton organization and cell migration. Promotes substrate adhesion, spreading and formation of focal contacts. Negatively regulates cell-matrix adhesion and stress fiber assembly through Rho protein signal transduction. Modulates the organization of actin cytoskeleton by stimulating the formation of stress fibers through interactions with components of Wnt signaling pathways. Promotes cell migration through activation of PTK2 and the downstream phosphatidylinositol 3-kinase signaling. Plays a role in bone formation and promotes osteoblast differentiation in a dose-dependent manner through mitogen-activated protein kinase signaling. Mediates myelination in the peripheral nervous system through ERBB2/ERBB3 signaling. Plays a role as a regulator of muscle hypertrophy through the components of dystrophin-associated protein complex. Involved in positive regulation of mitochondrial depolarization. Plays a role in neurite outgrowth. May participate in the obstruction of fluid outflow in the trabecular meshwork.
Mitotic Index	0.0222
Interphase Cluster:	#42 (31 genes)
Mitotic Cluster:	#18 (40 genes)
sgRNA 1:	CCATCTGGCTATCTCAGGAG (interphase cells: 1677, mitotic cells: 40)
sgRNA 2:	GTTGACGGTAGCATCTGCTG (interphase cells: 2603, mitotic cells: 52)
sgRNA 3:	TAAGTTATGGATGACTGACA (interphase cells: 2365, mitotic cells: 50)
sgRNA 4:	TGGCCTCCAGGTCTAAGCGT (interphase cells: 1562, mitotic cells: 44)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.001	3059 of 5322	0.991
Nucleus	DNA	Mean	0.013	1590 of 5322	0.743
Nucleus	gH2AX	Mean	0.121	1488 of 5322	0.002
Nucleus	DNA - gH2AX	Correlation	-5.637e-02	2648 of 5322	0.032
Nucleus	Shape	Area	-4.238e-03	3444 of 5322	0.857
Nucleus	Shape	Eccentricity	0.007	2920 of 5322	0.853
Nucleus	Shape	Form Factor	-2.192e-02	1361 of 5322	0.614
Nucleus	Shape	Solidity	-3.545e-02	2011 of 5322	0.271
Cell	DNA	Mass Displacement	0.020	3033 of 5322	0.762
Cell	Tubulin	Mean	0.032	1600 of 5322	0.430
Cell	Tubulin	Mass Displacement	0.016	2018 of 5322	0.800
Cell	Actin	Mean	0.015	2504 of 5322	0.764
Cell	Tubulin - Actin	Correlation	0.021	2612 of 5322	0.637
Cell	DNA - Tubulin	Correlation	0.003	3708 of 5322	0.961
Cell	Shape	Area	9.551e-04	3199 of 5322	0.925
Cell	Shape	Eccentricity	0.013	2658 of 5322	0.884
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.029	3539 of 5322	0.996
Nucleus	DNA	Mean	0.085	1659 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.006	3433 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.150	985 of 5322	1.000
Nucleus	gH2AX	Mean	-1.300e-02	3122 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	-2.079e-01	4843 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	-1.034e-01	4705 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.350	184 of 5322	0.595
Nucleus	Tubulin	Std Edge	0.177	590 of 5322	0.999
Nucleus	Shape	Area	-7.936e-03	4031 of 5322	0.990
Nucleus	Shape	Eccentricity	-1.060e-01	3654 of 5322	1.000
Nucleus	Shape	Form Factor	-2.972e-02	1808 of 5322	0.998
Cell	Tubulin	Mean	0.252	640 of 5322	0.910
Cell	Tubulin	Mean Frac 3	0.111	641 of 5322	0.999
Cell	Actin	Mean	-1.573e-01	4844 of 5322	0.997
Cell	Shape	Area	-7.729e-02	4633 of 5322	0.998

MIT Central Accessability