LONP1

Gene symbol:	LONP1
Gene:	9361
Uniprot Function:	ATP-dependent serine protease that mediates the selective degradation of misfolded, unassembled or oxidatively damaged polypeptides as well as certain short-lived regulatory proteins in the mitochondrial matrix. May also have a chaperone function in the assembly of inner membrane protein complexes. Participates in the regulation of mitochondrial gene expression and in the maintenance of the integrity of the mitochondrial genome. Binds to mitochondrial promoters and RNA in a single-stranded, site-specific, and strand-specific manner. May regulate mitochondrial DNA replication and/or gene expression using site-specific, single-stranded DNA binding to target the degradation of regulatory proteins binding to adjacent sites in mitochondrial promoters (PubMed:12198491, PubMed:15870080, PubMed:17420247, PubMed:8248235). Endogenous substrates include mitochondrial steroidogenic acute regulatory (StAR) protein, helicase Twinkle (TWNK) and the large ribosomal subunit protein bL32m. bL32m is protected from degradation by LONP1 when it is bound to a nucleic acid (RNA), but TWNK is not (PubMed:17579211, PubMed:28377575).
Mitotic Index	0.0281
Interphase Cluster:	#141 (20 genes)
Mitotic Cluster:	#116 (23 genes)
sgRNA 1:	TCGATAATCTTGATAAAGCG (interphase cells: 1440, mitotic cells: 50)
sgRNA 2:	TCTGGGCAAACGTCCCCGTG (interphase cells: 2591, mitotic cells: 83)
sgRNA 3:	TGGCTCACGTCCATCCCTTG (interphase cells: 1987, mitotic cells: 50)
sgRNA 4:	TGGGAAGCGAGCAGCCGCGG (interphase cells: 1726, mitotic cells: 41)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	-9.176e-04	3164 of 5322	0.969
Nucleus	DNA	Mean	0.018	1437 of 5322	0.663
Nucleus	gH2AX	Mean	0.046	3633 of 5322	0.201
Nucleus	DNA - gH2AX	Correlation	-7.526e-02	3277 of 5322	0.004
Nucleus	Shape	Area	-5.798e-02	4556 of 5322	0.133
Nucleus	Shape	Eccentricity	0.075	415 of 5322	0.024
Nucleus	Shape	Form Factor	-2.720e-02	1598 of 5322	0.512
Nucleus	Shape	Solidity	-4.173e-02	2323 of 5322	0.195
Cell	DNA	Mass Displacement	0.017	3223 of 5322	0.812
Cell	Tubulin	Mean	-3.741e-02	4032 of 5322	0.440
Cell	Tubulin	Mass Displacement	0.019	1860 of 5322	0.757
Cell	Actin	Mean	-1.425e-02	3468 of 5322	0.840
Cell	Tubulin - Actin	Correlation	0.026	2381 of 5322	0.547
Cell	DNA - Tubulin	Correlation	0.021	2998 of 5322	0.627
Cell	Shape	Area	-4.720e-02	4335 of 5322	0.250
Cell	Shape	Eccentricity	0.050	565 of 5322	0.298
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.016	3719 of 5322	0.996
Nucleus	DNA	Mean	-4.131e-02	3597 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.067	2428 of 5322	0.999
Nucleus	DNA	Mean Frac 3	-3.385e-02	3629 of 5322	1.000
Nucleus	gH2AX	Mean	0.093	1698 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.164	499 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.007	3385 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.106	1789 of 5322	0.999
Nucleus	Tubulin	Std Edge	0.127	979 of 5322	0.999
Nucleus	Shape	Area	-6.028e-02	4534 of 5322	0.990
Nucleus	Shape	Eccentricity	0.100	858 of 5322	1.000
Nucleus	Shape	Form Factor	0.032	995 of 5322	0.998
Cell	Tubulin	Mean	0.012	3334 of 5322	1.000
Cell	Tubulin	Mean Frac 3	-9.811e-02	2921 of 5322	0.999
Cell	Actin	Mean	0.084	2092 of 5322	0.997
Cell	Shape	Area	-2.947e-02	4247 of 5322	0.998

MIT Central Accessability