KDM8

Gene symbol:	KDM8
Gene:	79831
Uniprot Function:	Bifunctional enzyme that acts both as an endopeptidase and 2-oxoglutarate-dependent monoxygenase (PubMed:28847961, PubMed:29459673, PubMed:28982940, PubMed:29563586). Endopeptidase that cleaves histones N-terminal tails at the carboxyl side of methylated arginine or lysine residues, to generate 'tailless nucleosomes', which may trigger transcription elongation (PubMed:28847961, PubMed:29459673, PubMed:28982940). Preferentially recognizes and cleaves monomethylated and dimethylated arginine residues of histones H2, H3 and H4. After initial cleavage, continues to digest histones tails via its aminopeptidase activity (PubMed:28847961, PubMed:29459673). Upon DNA damage, cleaves the N-terminal tail of histone H3 at monomethylated lysine residues, preferably at monomethylated 'Lys-9' (H3K9me1). The histone variant H3F3A is the major target for cleavage (PubMed:28982940). Additionnally, acts as Fe(2+) and 2-oxoglutarate-dependent monoxygenase, catalyzing (R)-stereospecific hydroxylation at C-3 of 'Arg-137' of RPS6 and 'Arg-141' of RCCD1, but the biological significance of this activity remains to be established (PubMed:29563586). Regulates mitosis through different mechanisms: Plays a role in transcriptional repression of satellite repeats, possibly by regulating H3K36 methylation levels in centromeric regions together with RCCD1. Possibly together with RCCD1, is involved in proper mitotic spindle organization and chromosome segregation (PubMed:24981860). Negatively regulates cell cycle repressor CDKN1A/p21, which controls G1/S phase transition (PubMed:24740926). Required for G2/M phase cell cycle progression. Regulates expression of CCNA1/cyclin-A1, leading to cancer cell proliferation (PubMed:20457893). Also, plays a role in regulating alpha-tubulin acetylation and cytoskeletal microtubule stability involved in epithelial to mesenchymal transition (PubMed:28455245). Regulates the circadian gene expression in the liver (By similarity). Represses the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer in a catalytically-independent manner (PubMed:30500822). Negatively regulates the protein stability and function of CRY1; required for AMPK-FBXL3-induced CRY1 degradation (PubMed:30500822).
Mitotic Index	0.0285
Interphase Cluster:	#51 (30 genes)
Mitotic Cluster:	#18 (40 genes)
sgRNA 1:	AGACCTGAAGTTGGACCTCG (interphase cells: 755, mitotic cells: 21)
sgRNA 2:	CAGAAAGCAAGGGCGGACCA (interphase cells: 2103, mitotic cells: 58)
sgRNA 3:	GAACTCGTTGACCGTCATGA (interphase cells: 812, mitotic cells: 21)
sgRNA 4:	TCCTGGGAGAAGCTCAACAC (interphase cells: 1844, mitotic cells: 62)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.006	2849 of 5322	0.979
Nucleus	DNA	Mean	-1.017e-01	4603 of 5322	0.015
Nucleus	gH2AX	Mean	0.095	2077 of 5322	0.022
Nucleus	DNA - gH2AX	Correlation	-2.546e-02	1577 of 5322	0.397
Nucleus	Shape	Area	0.058	1438 of 5322	0.323
Nucleus	Shape	Eccentricity	0.059	710 of 5322	0.123
Nucleus	Shape	Form Factor	-1.824e-02	1184 of 5322	0.730
Nucleus	Shape	Solidity	6.917e-04	618 of 5322	0.972
Cell	DNA	Mass Displacement	-1.247e-02	4884 of 5322	0.820
Cell	Tubulin	Mean	0.013	2232 of 5322	0.784
Cell	Tubulin	Mass Displacement	-2.647e-03	3183 of 5322	0.986
Cell	Actin	Mean	-7.555e-02	4731 of 5322	0.109
Cell	Tubulin - Actin	Correlation	-3.873e-02	4889 of 5322	0.401
Cell	DNA - Tubulin	Correlation	-2.437e-02	4577 of 5322	0.577
Cell	Shape	Area	0.021	2458 of 5322	0.882
Cell	Shape	Eccentricity	0.017	2361 of 5322	0.859
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.082	2749 of 5322	0.984
Nucleus	DNA	Mean	-5.779e-02	3814 of 5322	1.000
Nucleus	DNA	Mass Displacement	-1.358e-01	4955 of 5322	0.999
Nucleus	DNA	Mean Frac 3	-7.899e-02	4208 of 5322	1.000
Nucleus	gH2AX	Mean	0.354	231 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	-7.751e-02	3471 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.125	1610 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.220	663 of 5322	0.999
Nucleus	Tubulin	Std Edge	0.041	1983 of 5322	0.999
Nucleus	Shape	Area	0.045	3410 of 5322	0.990
Nucleus	Shape	Eccentricity	0.056	1304 of 5322	1.000
Nucleus	Shape	Form Factor	-8.069e-02	2578 of 5322	0.998
Cell	Tubulin	Mean	0.292	462 of 5322	0.997
Cell	Tubulin	Mean Frac 3	-3.384e-01	4873 of 5322	0.999
Cell	Actin	Mean	0.072	2253 of 5322	0.997
Cell	Shape	Area	0.129	2216 of 5322	0.998

MIT Central Accessability