GPR132

Gene symbol:	GPR132
Gene:	29933
Uniprot Function:	May be a receptor for oxidized free fatty acids derived from linoleic and arachidonic acids such as 9-hydroxyoctadecadienoic acid (9-HODE). Activates a G alpha protein, most likely G alpha(q). May be involved in apoptosis. Functions at the G2/M checkpoint to delay mitosis. May function as a sensor that monitors the oxidative states and mediates appropriate cellular responses such as secretion of paracrine signals and attenuation of proliferation. May mediate ths accumulation of intracellular inositol phosphates at acidic pH through proton-sensing activity.
Mitotic Index	0.0229
Interphase Cluster:	#89 (25 genes)
Mitotic Cluster:	#141 (20 genes)
sgRNA 1:	GCTCCTGAAAATCCGGTGGT (interphase cells: 1343, mitotic cells: 35)
sgRNA 2:	GGTAGTGAACGATCCCGACG (interphase cells: 1155, mitotic cells: 26)
sgRNA 3:	GGTGAAGCACTCGGCCATCG (interphase cells: 2073, mitotic cells: 40)
sgRNA 4:	GTGTACGCGCTGGAGAGTCG (interphase cells: 1665, mitotic cells: 45)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.017	2264 of 5322	0.858
Nucleus	DNA	Mean	-1.137e-02	2342 of 5322	0.859
Nucleus	gH2AX	Mean	0.109	1731 of 5322	0.009
Nucleus	DNA - gH2AX	Correlation	-4.746e-02	2319 of 5322	0.095
Nucleus	Shape	Area	0.032	2223 of 5322	0.661
Nucleus	Shape	Eccentricity	0.060	696 of 5322	0.092
Nucleus	Shape	Form Factor	-3.753e-02	2061 of 5322	0.352
Nucleus	Shape	Solidity	-2.026e-02	1323 of 5322	0.583
Cell	DNA	Mass Displacement	0.002	4233 of 5322	0.998
Cell	Tubulin	Mean	0.009	2431 of 5322	0.842
Cell	Tubulin	Mass Displacement	0.019	1863 of 5322	0.780
Cell	Actin	Mean	0.009	2694 of 5322	0.871
Cell	Tubulin - Actin	Correlation	0.013	3058 of 5322	0.803
Cell	DNA - Tubulin	Correlation	0.048	1960 of 5322	0.193
Cell	Shape	Area	0.013	2761 of 5322	0.973
Cell	Shape	Eccentricity	0.009	2976 of 5322	0.928
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.019	3688 of 5322	0.996
Nucleus	DNA	Mean	0.079	1737 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.042	2833 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.088	1746 of 5322	1.000
Nucleus	gH2AX	Mean	0.130	1302 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.039	1704 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.159	1227 of 5322	0.999
Nucleus	Tubulin	Mean Edge	-4.173e-02	3714 of 5322	0.999
Nucleus	Tubulin	Std Edge	-4.091e-02	3131 of 5322	0.999
Nucleus	Shape	Area	0.114	2457 of 5322	0.989
Nucleus	Shape	Eccentricity	-7.399e-03	2232 of 5322	1.000
Nucleus	Shape	Form Factor	0.104	391 of 5322	0.998
Cell	Tubulin	Mean	-7.242e-02	4349 of 5322	0.997
Cell	Tubulin	Mean Frac 3	0.016	1508 of 5322	0.999
Cell	Actin	Mean	0.014	3014 of 5322	1.000
Cell	Shape	Area	0.123	2287 of 5322	0.998

MIT Central Accessability