EZH2

Gene symbol:	EZH2
Gene:	2146
Uniprot Function:	Polycomb group (PcG) protein. Catalytic subunit of the PRC2/EED-EZH2 complex, which methylates 'Lys-9' (H3K9me) and 'Lys-27' (H3K27me) of histone H3, leading to transcriptional repression of the affected target gene. Able to mono-, di- and trimethylate 'Lys-27' of histone H3 to form H3K27me1, H3K27me2 and H3K27me3, respectively. Displays a preference for substrates with less methylation, loses activity when progressively more methyl groups are incorporated into H3K27, H3K27me0 > H3K27me1 > H3K27me2 (PubMed:22323599, PubMed:30923826). Compared to EZH1-containing complexes, it is more abundant in embryonic stem cells and plays a major role in forming H3K27me3, which is required for embryonic stem cell identity and proper differentiation. The PRC2/EED-EZH2 complex may also serve as a recruiting platform for DNA methyltransferases, thereby linking two epigenetic repression systems. Genes repressed by the PRC2/EED-EZH2 complex include HOXC8, HOXA9, MYT1, CDKN2A and retinoic acid target genes. EZH2 can also methylate non-histone proteins such as the transcription factor GATA4 and the nuclear receptor RORA. Regulates the circadian clock via histone methylation at the promoter of the circadian genes. Essential for the CRY1/2-mediated repression of the transcriptional activation of PER1/2 by the CLOCK-ARNTL/BMAL1 heterodimer; involved in the di and trimethylation of 'Lys-27' of histone H3 on PER1/2 promoters which is necessary for the CRY1/2 proteins to inhibit transcription.
Mitotic Index	0.0232
Interphase Cluster:	#51 (30 genes)
Mitotic Cluster:	#116 (23 genes)
sgRNA 1:	ACCAAGAATGGAAACAGCGA (interphase cells: 1297, mitotic cells: 36)
sgRNA 2:	CTTCTGTGAGCTCATTGCGC (interphase cells: 1086, mitotic cells: 29)
sgRNA 3:	GATCTGGAGGATCACCGAGA (interphase cells: 915, mitotic cells: 22)
sgRNA 4:	TCAGAAGGAAATTTCCGAGG (interphase cells: 1157, mitotic cells: 19)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.029	1735 of 5322	0.746
Nucleus	DNA	Mean	-1.324e-01	4861 of 5322	0.002
Nucleus	gH2AX	Mean	0.013	4390 of 5322	0.776
Nucleus	DNA - gH2AX	Correlation	-9.860e-02	3949 of 5322	0.002
Nucleus	Shape	Area	0.115	588 of 5322	0.025
Nucleus	Shape	Eccentricity	0.085	311 of 5322	0.022
Nucleus	Shape	Form Factor	-7.255e-02	3656 of 5322	0.076
Nucleus	Shape	Solidity	-6.671e-02	3393 of 5322	0.063
Cell	DNA	Mass Displacement	0.049	1202 of 5322	0.398
Cell	Tubulin	Mean	-3.453e-02	3948 of 5322	0.537
Cell	Tubulin	Mass Displacement	0.051	589 of 5322	0.271
Cell	Actin	Mean	-1.217e-01	5040 of 5322	0.005
Cell	Tubulin - Actin	Correlation	0.014	2978 of 5322	0.803
Cell	DNA - Tubulin	Correlation	0.027	2706 of 5322	0.557
Cell	Shape	Area	0.067	1081 of 5322	0.283
Cell	Shape	Eccentricity	0.068	222 of 5322	0.203
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.241	899 of 5322	0.824
Nucleus	DNA	Mean	-3.028e-02	3439 of 5322	1.000
Nucleus	DNA	Mass Displacement	-1.235e-01	4870 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.044	2435 of 5322	1.000
Nucleus	gH2AX	Mean	0.013	2782 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.097	988 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.029	3054 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.026	2799 of 5322	0.999
Nucleus	Tubulin	Std Edge	0.101	1252 of 5322	0.999
Nucleus	Shape	Area	0.294	820 of 5322	0.747
Nucleus	Shape	Eccentricity	0.067	1167 of 5322	1.000
Nucleus	Shape	Form Factor	0.079	550 of 5322	0.998
Cell	Tubulin	Mean	0.141	1531 of 5322	0.997
Cell	Tubulin	Mean Frac 3	-2.685e-01	4561 of 5322	0.999
Cell	Actin	Mean	0.164	1161 of 5322	0.997
Cell	Shape	Area	0.197	1417 of 5322	0.994

MIT Central Accessability