EIF3A

Gene symbol:	EIF3A
Gene:	8661
Uniprot Function:	RNA-binding component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis (PubMed:17581632, PubMed:25849773). The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation (PubMed:17581632, PubMed:11169732). The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression (PubMed:25849773, PubMed:27462815).
Mitotic Index	0.022
Interphase Cluster:	#66 (29 genes)
Mitotic Cluster:	#5 (49 genes)
sgRNA 1:	AAGGCCAATTCGTGTCGGTG (interphase cells: 668, mitotic cells: 14)
sgRNA 2:	AATGCCCTCAAACGCGCCAA (interphase cells: 1366, mitotic cells: 30)
sgRNA 3:	TCAATGGAGGACTCTCGTTG (interphase cells: 201, mitotic cells: 2)
sgRNA 4:	TTTGATAAAGAGCGCTTACG (interphase cells: 346, mitotic cells: 12)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.433	54 of 5322	5.407e-04
Nucleus	DNA	Mean	1.348	6 of 5322	1.505e-04
Nucleus	gH2AX	Mean	0.520	91 of 5322	1.367e-04
Nucleus	DNA - gH2AX	Correlation	0.434	7 of 5322	1.021e-04
Nucleus	Shape	Area	-7.253e-01	5303 of 5322	1.633e-04
Nucleus	Shape	Eccentricity	-2.472e-01	5293 of 5322	4.529e-04
Nucleus	Shape	Form Factor	0.042	119 of 5322	0.330
Nucleus	Shape	Solidity	-1.080e-01	4434 of 5322	0.021
Cell	DNA	Mass Displacement	0.044	1446 of 5322	0.629
Cell	Tubulin	Mean	0.428	49 of 5322	2.141e-04
Cell	Tubulin	Mass Displacement	0.015	2106 of 5322	0.891
Cell	Actin	Mean	0.303	141 of 5322	1.723e-04
Cell	Tubulin - Actin	Correlation	0.135	348 of 5322	0.008
Cell	DNA - Tubulin	Correlation	0.592	22 of 5322	1.948e-04
Cell	Shape	Area	-6.991e-01	5296 of 5322	1.651e-04
Cell	Shape	Eccentricity	-4.200e-02	5132 of 5322	0.727
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	-3.829e-03	3988 of 5322	0.996
Nucleus	DNA	Mean	0.003	2910 of 5322	1.000
Nucleus	DNA	Mass Displacement	-1.750e-01	5122 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.390	87 of 5322	1.000
Nucleus	gH2AX	Mean	0.004	2906 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	-1.926e-01	4752 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.136	1492 of 5322	0.999
Nucleus	Tubulin	Mean Edge	-5.549e-02	3866 of 5322	0.999
Nucleus	Tubulin	Std Edge	0.037	2044 of 5322	0.999
Nucleus	Shape	Area	0.287	852 of 5322	0.902
Nucleus	Shape	Eccentricity	-2.385e-01	4736 of 5322	1.000
Nucleus	Shape	Form Factor	-1.199e-01	3131 of 5322	0.998
Cell	Tubulin	Mean	0.131	1665 of 5322	0.997
Cell	Tubulin	Mean Frac 3	-2.917e-01	4678 of 5322	0.999
Cell	Actin	Mean	-2.257e-02	3522 of 5322	0.997
Cell	Shape	Area	-5.961e-02	4512 of 5322	0.998

MIT Central Accessability