ECT2

Gene symbol:	ECT2
Gene:	1894
Uniprot Function:	Guanine nucleotide exchange factor (GEF) that catalyzes the exchange of GDP for GTP. Promotes guanine nucleotide exchange on the Rho family members of small GTPases, like RHOA, RHOC, RAC1 and CDC42. Required for signal transduction pathways involved in the regulation of cytokinesis. Component of the centralspindlin complex that serves as a microtubule-dependent and Rho-mediated signaling required for the myosin contractile ring formation during the cell cycle cytokinesis. Regulates the translocation of RHOA from the central spindle to the equatorial region. Plays a role in the control of mitotic spindle assembly; regulates the activation of CDC42 in metaphase for the process of spindle fibers attachment to kinetochores before chromosome congression. Involved in the regulation of epithelial cell polarity; participates in the formation of epithelial tight junctions in a polarity complex PARD3-PARD6-protein kinase PRKCQ-dependent manner. Plays a role in the regulation of neurite outgrowth. Inhibits phenobarbital (PB)-induced NR1I3 nuclear translocation. Stimulates the activity of RAC1 through its association with the oncogenic PARD6A-PRKCI complex in cancer cells, thereby acting to coordinately drive tumor cell proliferation and invasion. Also stimulates genotoxic stress-induced RHOB activity in breast cancer cells leading to their cell death.
Mitotic Index	0.0285
Interphase Cluster:	#148 (19 genes)
Mitotic Cluster:	#46 (30 genes)
sgRNA 1:	GAGTCTAGCATTAACTATGG (interphase cells: 1709, mitotic cells: 63)
sgRNA 2:	GTGACATTGGTCCATCACAT (interphase cells: 202, mitotic cells: 3)
sgRNA 3:	TATTAACATCCACTACTGGG (interphase cells: 1965, mitotic cells: 48)
sgRNA 4:	TTCTTATCCGACCAGTACAG (interphase cells: 288, mitotic cells: 8)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 36.43 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.184	188 of 5322	0.004
Nucleus	DNA	Mean	-1.440e-02	2457 of 5322	0.852
Nucleus	gH2AX	Mean	0.028	4084 of 5322	0.582
Nucleus	DNA - gH2AX	Correlation	-2.054e-01	5132 of 5322	1.021e-04
Nucleus	Shape	Area	0.133	464 of 5322	0.029
Nucleus	Shape	Eccentricity	0.174	35 of 5322	4.529e-04
Nucleus	Shape	Form Factor	-2.859e-01	5289 of 5322	2.872e-04
Nucleus	Shape	Solidity	-3.258e-01	5302 of 5322	1.903e-04
Cell	DNA	Mass Displacement	0.410	4 of 5322	0.001
Cell	Tubulin	Mean	0.153	268 of 5322	0.002
Cell	Tubulin	Mass Displacement	0.339	11 of 5322	3.984e-04
Cell	Actin	Mean	-7.105e-02	4677 of 5322	0.237
Cell	Tubulin - Actin	Correlation	0.031	2164 of 5322	0.628
Cell	DNA - Tubulin	Correlation	-1.137e-02	4216 of 5322	0.850
Cell	Shape	Area	0.078	893 of 5322	0.280
Cell	Shape	Eccentricity	0.080	131 of 5322	0.272
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.391	287 of 5322	0.663
Nucleus	DNA	Mean	0.285	268 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.028	3063 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.304	203 of 5322	1.000
Nucleus	gH2AX	Mean	-6.900e-02	3901 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.053	1503 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	-6.952e-02	4398 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.085	2047 of 5322	0.999
Nucleus	Tubulin	Std Edge	0.108	1179 of 5322	0.999
Nucleus	Shape	Area	0.107	2565 of 5322	0.990
Nucleus	Shape	Eccentricity	-1.378e-01	4011 of 5322	1.000
Nucleus	Shape	Form Factor	0.066	634 of 5322	0.998
Cell	Tubulin	Mean	0.145	1497 of 5322	0.997
Cell	Tubulin	Mean Frac 3	-4.196e-01	5071 of 5322	0.801
Cell	Actin	Mean	-2.186e-01	5081 of 5322	0.997
Cell	Shape	Area	0.128	2229 of 5322	0.998

MIT Central Accessability