CEBPA

Gene symbol:	CEBPA
Gene:	1050
Uniprot Function:	Transcription factor that coordinates proliferation arrest and the differentiation of myeloid progenitors, adipocytes, hepatocytes, and cells of the lung and the placenta. Binds directly to the consensus DNA sequence 5'-T[TG]NNGNAA[TG]-3' acting as an activator on distinct target genes (PubMed:11242107). During early embryogenesis, plays essential and redundant functions with CEBPB. Essential for the transition from common myeloid progenitors (CMP) to granulocyte/monocyte progenitors (GMP). Critical for the proper development of the liver and the lung (By similarity). Necessary for terminal adipocyte differentiation, is required for postnatal maintenance of systemic energy homeostasis and lipid storage (By similarity). To regulate these different processes at the proper moment and tissue, interplays with other transcription factors and modulators. Downregulates the expression of genes that maintain cells in an undifferentiated and proliferative state through E2F1 repression, which is critical for its ability to induce adipocyte and granulocyte terminal differentiation. Reciprocally E2F1 blocks adipocyte differentiation by binding to specific promoters and repressing CEBPA binding to its target gene promoters. Proliferation arrest also depends on a functional binding to SWI/SNF complex (PubMed:14660596). In liver, regulates gluconeogenesis and lipogenesis through different mechanisms. To regulate gluconeogenesis, functionally cooperates with FOXO1 binding to IRE-controlled promoters and regulating the expression of target genes such as PCK1 or G6PC1. To modulate lipogenesis, interacts and transcriptionally synergizes with SREBF1 in promoter activation of specific lipogenic target genes such as ACAS2. In adipose tissue, seems to act as FOXO1 coactivator accessing to ADIPOQ promoter through FOXO1 binding sites (By similarity).
Mitotic Index	0.0275
Interphase Cluster:	#208 (9 genes)
Mitotic Cluster:	#140 (20 genes)
sgRNA 1:	CACCCCGACCTCCGCGCGAG (interphase cells: 1641, mitotic cells: 41)
sgRNA 2:	CCTGCCGTCCAGGTAGCCGG (interphase cells: 1281, mitotic cells: 36)
sgRNA 3:	GTCGGCCGACTTCTACGAGG (interphase cells: 269, mitotic cells: 12)
sgRNA 4:	TGAAGCCAAGCAGCTGGCGC (interphase cells: 2785, mitotic cells: 80)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.055	908 of 5322	0.432
Nucleus	DNA	Mean	-1.777e-02	2547 of 5322	0.779
Nucleus	gH2AX	Mean	0.083	2441 of 5322	0.056
Nucleus	DNA - gH2AX	Correlation	-5.321e-02	2539 of 5322	0.093
Nucleus	Shape	Area	0.066	1265 of 5322	0.272
Nucleus	Shape	Eccentricity	0.008	2885 of 5322	0.868
Nucleus	Shape	Form Factor	0.012	409 of 5322	0.689
Nucleus	Shape	Solidity	0.011	405 of 5322	0.753
Cell	DNA	Mass Displacement	0.027	2544 of 5322	0.723
Cell	Tubulin	Mean	-1.023e-02	3181 of 5322	0.918
Cell	Tubulin	Mass Displacement	0.015	2089 of 5322	0.851
Cell	Actin	Mean	-1.525e-02	3502 of 5322	0.843
Cell	Tubulin - Actin	Correlation	0.015	2899 of 5322	0.788
Cell	DNA - Tubulin	Correlation	0.040	2251 of 5322	0.358
Cell	Shape	Area	0.025	2311 of 5322	0.835
Cell	Shape	Eccentricity	-4.079e-02	5120 of 5322	0.605
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.048	3262 of 5322	0.992
Nucleus	DNA	Mean	0.059	2039 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.327	188 of 5322	0.999
Nucleus	DNA	Mean Frac 3	-1.238e-01	4635 of 5322	1.000
Nucleus	gH2AX	Mean	0.006	2879 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.040	1691 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	-3.896e-02	4041 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.021	2869 of 5322	0.999
Nucleus	Tubulin	Std Edge	0.100	1264 of 5322	0.999
Nucleus	Shape	Area	0.140	2122 of 5322	0.988
Nucleus	Shape	Eccentricity	-1.148e-01	3764 of 5322	1.000
Nucleus	Shape	Form Factor	-9.702e-02	2809 of 5322	0.998
Cell	Tubulin	Mean	0.085	2261 of 5322	0.997
Cell	Tubulin	Mean Frac 3	0.073	948 of 5322	0.999
Cell	Actin	Mean	0.047	2556 of 5322	0.997
Cell	Shape	Area	0.080	2890 of 5322	0.998

MIT Central Accessability