ABCE1

Gene symbol:	ABCE1
Gene:	6059
Uniprot Function:	Cotranslational quality control factor involved in the No-Go Decay (NGD) pathway (PubMed:21448132). Together with PELO and HBS1L, is required for 48S complex formation from 80S ribosomes and dissociation of vacant 80S ribosomes (PubMed:21448132). Together with PELO and HBS1L, recognizes stalled ribosomes and promotes dissociation of elongation complexes assembled on non-stop mRNAs; this triggers endonucleolytic cleavage of the mRNA, a mechanism to release non-functional ribosomes and to degrade damaged mRNAs as part of the No-Go Decay (NGD) pathway (PubMed:21448132). Plays a role in the regulation of mRNA turnover (By similarity). Plays a role in quality control of translation of mitochondrial outer membrane-localized mRNA (PubMed:29861391). As part of the PINK1-regulated signaling, ubiquitinated by CNOT4 upon mitochondria damage; this modification generates polyubiquitin signals that recruit autophagy receptors to the mitochondrial outer membrane and initiate mitophagy (PubMed:29861391). RNASEL-specific protein inhibitor which antagonizes the binding of 2-5A (5'-phosphorylated 2',5'-linked oligoadenylates) to RNASEL (PubMed:9660177). Negative regulator of the anti-viral effect of the interferon-regulated 2-5A/RNASEL pathway (PubMed:9660177, PubMed:9847332, PubMed:11585831).
Mitotic Index	0.0232
Interphase Cluster:	#97 (24 genes)
Mitotic Cluster:	#191 (13 genes)
sgRNA 1:	AGTTGTCCTGTAGTTCGAAT (interphase cells: 1204, mitotic cells: 32)
sgRNA 2:	CCAAAACTTCACCTGGACGA (interphase cells: 1804, mitotic cells: 45)
sgRNA 3:	TATGGTGTACCAAGCGCCTA (interphase cells: 1082, mitotic cells: 28)
sgRNA 4:	TTTCAGATATATCATTGTGG (interphase cells: 2444, mitotic cells: 50)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.079	531 of 5322	0.138
Nucleus	DNA	Mean	-3.702e-02	3213 of 5322	0.422
Nucleus	gH2AX	Mean	0.073	2739 of 5322	0.056
Nucleus	DNA - gH2AX	Correlation	-1.759e-01	4982 of 5322	1.021e-04
Nucleus	Shape	Area	0.047	1760 of 5322	0.447
Nucleus	Shape	Eccentricity	-3.930e-02	4678 of 5322	0.356
Nucleus	Shape	Form Factor	-9.121e-02	4197 of 5322	0.017
Nucleus	Shape	Solidity	-9.084e-02	4110 of 5322	0.007
Cell	DNA	Mass Displacement	0.070	556 of 5322	0.123
Cell	Tubulin	Mean	-2.831e-02	3788 of 5322	0.607
Cell	Tubulin	Mass Displacement	0.134	118 of 5322	3.984e-04
Cell	Actin	Mean	-8.893e-02	4838 of 5322	0.042
Cell	Tubulin - Actin	Correlation	0.251	101 of 5322	2.896e-04
Cell	DNA - Tubulin	Correlation	0.329	129 of 5322	1.948e-04
Cell	Shape	Area	-8.012e-02	4686 of 5322	0.042
Cell	Shape	Eccentricity	0.013	2648 of 5322	0.893
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.188	1386 of 5322	0.875
Nucleus	DNA	Mean	0.078	1753 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.014	3304 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.165	866 of 5322	1.000
Nucleus	gH2AX	Mean	-4.189e-02	3537 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	-3.371e-01	5241 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.017	3230 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.151	1247 of 5322	0.999
Nucleus	Tubulin	Std Edge	0.040	1994 of 5322	0.999
Nucleus	Shape	Area	0.119	2392 of 5322	0.989
Nucleus	Shape	Eccentricity	0.207	210 of 5322	1.000
Nucleus	Shape	Form Factor	-1.835e-01	3973 of 5322	0.998
Cell	Tubulin	Mean	-1.390e-02	3686 of 5322	0.998
Cell	Tubulin	Mean Frac 3	-8.911e-02	2785 of 5322	0.999
Cell	Actin	Mean	0.069	2295 of 5322	0.997
Cell	Shape	Area	0.164	1799 of 5322	0.998

MIT Central Accessability