AAK1

Gene symbol:	AAK1
Gene:	22848
Uniprot Function:	Regulates clathrin-mediated endocytosis by phosphorylating the AP2M1/mu2 subunit of the adaptor protein complex 2 (AP-2) which ensures high affinity binding of AP-2 to cargo membrane proteins during the initial stages of endocytosis (PubMed:17494869, PubMed:11877457, PubMed:11877461, PubMed:12952931, PubMed:14617351, PubMed:25653444). Isoform 1 and isoform 2 display similar levels of kinase activity towards AP2M1 (PubMed:17494869). Preferentially, may phosphorylate substrates on threonine residues (PubMed:11877457, PubMed:18657069). Regulates phosphorylation of other AP-2 subunits as well as AP-2 localization and AP-2-mediated internalization of ligand complexes (PubMed:12952931). Phosphorylates NUMB and regulates its cellular localization, promoting NUMB localization to endosomes (PubMed:18657069). Binds to and stabilizes the activated form of NOTCH1, increases its localization in endosomes and regulates its transcriptional activity (PubMed:21464124).
Mitotic Index	0.0266
Interphase Cluster:	#54 (30 genes)
Mitotic Cluster:	#108 (23 genes)
sgRNA 1:	ATGGGAAGTGCTCATTCTGA (interphase cells: 1741, mitotic cells: 38)
sgRNA 2:	CAAAAGGCCGGATATTTACC (interphase cells: 689, mitotic cells: 16)
sgRNA 3:	GGGTGCAATTGAAGTCTCTG (interphase cells: 2489, mitotic cells: 81)
sgRNA 4:	TGGCAAAATCATCACTACGA (interphase cells: 1157, mitotic cells: 31)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	-1.463e-02	3813 of 5322	0.824
Nucleus	DNA	Mean	0.074	619 of 5322	0.062
Nucleus	gH2AX	Mean	0.135	1242 of 5322	0.002
Nucleus	DNA - gH2AX	Correlation	-1.216e-01	4421 of 5322	1.021e-04
Nucleus	Shape	Area	-7.262e-02	4686 of 5322	0.071
Nucleus	Shape	Eccentricity	0.049	951 of 5322	0.202
Nucleus	Shape	Form Factor	-6.579e-02	3391 of 5322	0.100
Nucleus	Shape	Solidity	-9.776e-02	4235 of 5322	0.006
Cell	DNA	Mass Displacement	0.021	2980 of 5322	0.780
Cell	Tubulin	Mean	0.043	1285 of 5322	0.321
Cell	Tubulin	Mass Displacement	0.036	1036 of 5322	0.491
Cell	Actin	Mean	0.106	762 of 5322	0.016
Cell	Tubulin - Actin	Correlation	0.121	423 of 5322	0.001
Cell	DNA - Tubulin	Correlation	0.027	2716 of 5322	0.543
Cell	Shape	Area	-1.436e-01	4925 of 5322	3.202e-04
Cell	Shape	Eccentricity	0.010	2958 of 5322	0.931
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.186	1403 of 5322	0.881
Nucleus	DNA	Mean	0.115	1296 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.149	1262 of 5322	0.999
Nucleus	DNA	Mean Frac 3	-1.714e-01	4915 of 5322	1.000
Nucleus	gH2AX	Mean	-3.633e-02	3449 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	-1.287e-01	4155 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	-6.663e-03	3610 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.251	493 of 5322	0.953
Nucleus	Tubulin	Std Edge	0.018	2306 of 5322	0.999
Nucleus	Shape	Area	0.110	2525 of 5322	0.989
Nucleus	Shape	Eccentricity	0.158	401 of 5322	1.000
Nucleus	Shape	Form Factor	-6.816e-02	2383 of 5322	0.998
Cell	Tubulin	Mean	0.285	486 of 5322	0.896
Cell	Tubulin	Mean Frac 3	-2.347e-01	4332 of 5322	0.999
Cell	Actin	Mean	0.047	2570 of 5322	0.997
Cell	Shape	Area	0.186	1539 of 5322	0.994

MIT Central Accessability