TNPO1

Gene symbol:	TNPO1
Gene:	3842
Uniprot Function:	Functions in nuclear protein import as nuclear transport receptor. Serves as receptor for nuclear localization signals (NLS) in cargo substrates (PubMed:24753571). Is thought to mediate docking of the importin/substrate complex to the nuclear pore complex (NPC) through binding to nucleoporin and the complex is subsequently translocated through the pore by an energy requiring, Ran-dependent mechanism. At the nucleoplasmic side of the NPC, Ran binds to the importin, the importin/substrate complex dissociates and importin is re-exported from the nucleus to the cytoplasm where GTP hydrolysis releases Ran. The directionality of nuclear import is thought to be conferred by an asymmetric distribution of the GTP- and GDP-bound forms of Ran between the cytoplasm and nucleus (By similarity). Involved in nuclear import of M9-containing proteins. In vitro, binds directly to the M9 region of the heterogeneous nuclear ribonucleoproteins (hnRNP), A1 and A2 and mediates their nuclear import. Appears also to be involved in hnRNP A1/A2 nuclear export. Mediates the nuclear import of ribosomal proteins RPL23A, RPS7 and RPL5. Binds to a beta-like import receptor binding (BIB) domain of RPL23A. In vitro, mediates nuclear import of H2A, H2B, H3 and H4 histones, and SRP19 (By similarity). Mediates nuclear import of ADAR/ADAR1 isoform 1 and isoform 5 in a RanGTP-dependent manner (PubMed:19124606, PubMed:24753571).
Mitotic Index	0.0197
Interphase Cluster:	#221 (4 genes)
Mitotic Cluster:	#115 (23 genes)
sgRNA 1:	ATCACAACTATAGCCTCCAA (interphase cells: 1342, mitotic cells: 27)
sgRNA 2:	CGAGCAACATCACAAGTGCT (interphase cells: 140, mitotic cells: 3)
sgRNA 3:	GTCCTCGATCGGTGAAAACG (interphase cells: 1279, mitotic cells: 27)
sgRNA 4:	TGACCACCCAGTGTGCATAG (interphase cells: 825, mitotic cells: 15)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	-5.636e-02	4965 of 5322	0.358
Nucleus	DNA	Mean	-6.792e-02	4050 of 5322	0.197
Nucleus	gH2AX	Mean	0.032	3996 of 5322	0.507
Nucleus	DNA - gH2AX	Correlation	-1.303e-01	4529 of 5322	4.964e-04
Nucleus	Shape	Area	-9.147e-02	4803 of 5322	0.054
Nucleus	Shape	Eccentricity	0.054	840 of 5322	0.283
Nucleus	Shape	Form Factor	-1.397e-01	4904 of 5322	0.002
Nucleus	Shape	Solidity	-1.588e-01	4936 of 5322	1.903e-04
Cell	DNA	Mass Displacement	-1.865e-02	5039 of 5322	0.789
Cell	Tubulin	Mean	0.074	731 of 5322	0.143
Cell	Tubulin	Mass Displacement	0.032	1188 of 5322	0.667
Cell	Actin	Mean	-2.018e-01	5225 of 5322	1.723e-04
Cell	Tubulin - Actin	Correlation	0.115	462 of 5322	0.012
Cell	DNA - Tubulin	Correlation	0.014	3282 of 5322	0.837
Cell	Shape	Area	-1.926e-01	5009 of 5322	1.651e-04
Cell	Shape	Eccentricity	0.018	2266 of 5322	0.890
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	-2.470e-02	4218 of 5322	0.996
Nucleus	DNA	Mean	-1.850e-01	4911 of 5322	1.000
Nucleus	DNA	Mass Displacement	-2.063e-01	5193 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.016	2878 of 5322	1.000
Nucleus	gH2AX	Mean	-9.146e-02	4151 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	-1.948e-01	4770 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	-1.713e-01	5060 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.273	400 of 5322	0.996
Nucleus	Tubulin	Std Edge	0.063	1696 of 5322	0.999
Nucleus	Shape	Area	0.153	1968 of 5322	0.989
Nucleus	Shape	Eccentricity	-4.403e-01	5163 of 5322	1.000
Nucleus	Shape	Form Factor	0.007	1301 of 5322	0.998
Cell	Tubulin	Mean	0.228	770 of 5322	0.997
Cell	Tubulin	Mean Frac 3	-5.999e-02	2446 of 5322	0.999
Cell	Actin	Mean	0.340	253 of 5322	0.997
Cell	Shape	Area	0.159	1866 of 5322	0.998

MIT Central Accessability