TENT4B

Gene symbol:	TENT4B
Gene:	64282
Uniprot Function:	Terminal nucleotidyltransferase that catalyzes preferentially the transfert of ATP and GTP on RNA 3' poly(A) tail creating a heterogeneous 3' poly(A) tail leading to mRNAs stabilization by protecting mRNAs from active deadenylation (PubMed:21788334, PubMed:30026317). Also functions as a catalytic subunit of a TRAMP-like complex which has a poly(A) RNA polymerase activity and is involved in a post-transcriptional quality control mechanism. Polyadenylation with short oligo(A) tails is required for the degradative activity of the exosome on several of its nuclear RNA substrates. Doesn't need a cofactor for polyadenylation activity (in vitro) (PubMed:21788334, PubMed:21855801). Required for cytoplasmic polyadenylation of mRNAs involved in carbohydrate metabolism, including the glucose transporter SLC2A1/GLUT1 (PubMed:28383716). Plays a role in replication-dependent histone mRNA degradation, probably through terminal uridylation of mature histone mRNAs. May play a role in sister chromatid cohesion (PubMed:18172165). Mediates 3' adenylation of the microRNA MIR21 followed by its 3'-to-5' trimming by the exoribonuclease PARN leading to degradation (PubMed:25049417). Mediates 3' adenylation of H/ACA box snoRNAs (small nucleolar RNAs) followed by its 3'-to-5' trimming by the exoribonuclease PARN which enhances snoRNA stability and maturation (PubMed:22442037).
Mitotic Index	0.0237
Interphase Cluster:	#24 (39 genes)
Mitotic Cluster:	#140 (20 genes)
sgRNA 1:	AAACGGAGGAACTACAACCA (interphase cells: 1310, mitotic cells: 25)
sgRNA 2:	ACTGGCATCCGGATAAAGGA (interphase cells: 1647, mitotic cells: 40)
sgRNA 3:	GAAGGGACTCACGTCAGCGC (interphase cells: 1020, mitotic cells: 29)
sgRNA 4:	TGTTGGAAGGAGTTCATATG (interphase cells: 2207, mitotic cells: 56)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.034	1541 of 5322	0.659
Nucleus	DNA	Mean	-1.854e-02	2580 of 5322	0.743
Nucleus	gH2AX	Mean	0.024	4167 of 5322	0.541
Nucleus	DNA - gH2AX	Correlation	0.038	423 of 5322	0.276
Nucleus	Shape	Area	0.074	1107 of 5322	0.163
Nucleus	Shape	Eccentricity	0.003	3187 of 5322	0.932
Nucleus	Shape	Form Factor	-4.241e-02	2306 of 5322	0.284
Nucleus	Shape	Solidity	-3.053e-02	1772 of 5322	0.380
Cell	DNA	Mass Displacement	0.005	4073 of 5322	0.976
Cell	Tubulin	Mean	-7.284e-02	4685 of 5322	0.095
Cell	Tubulin	Mass Displacement	-6.876e-02	4989 of 5322	0.067
Cell	Actin	Mean	-1.175e-01	5013 of 5322	0.004
Cell	Tubulin - Actin	Correlation	-5.325e-02	5052 of 5322	0.178
Cell	DNA - Tubulin	Correlation	-3.999e-02	4845 of 5322	0.285
Cell	Shape	Area	0.068	1059 of 5322	0.247
Cell	Shape	Eccentricity	-1.909e-02	4715 of 5322	0.855
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.183	1434 of 5322	0.884
Nucleus	DNA	Mean	-2.814e-02	3407 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.065	2457 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.126	1256 of 5322	1.000
Nucleus	gH2AX	Mean	-8.401e-02	4074 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	-1.183e-01	4040 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.099	2000 of 5322	0.999
Nucleus	Tubulin	Mean Edge	-6.620e-02	3987 of 5322	0.999
Nucleus	Tubulin	Std Edge	-9.610e-02	3847 of 5322	0.999
Nucleus	Shape	Area	0.223	1277 of 5322	0.852
Nucleus	Shape	Eccentricity	-1.599e-01	4212 of 5322	1.000
Nucleus	Shape	Form Factor	-2.608e-01	4601 of 5322	0.976
Cell	Tubulin	Mean	0.005	3426 of 5322	1.000
Cell	Tubulin	Mean Frac 3	-4.643e-02	2253 of 5322	0.999
Cell	Actin	Mean	0.017	2979 of 5322	1.000
Cell	Shape	Area	0.079	2904 of 5322	0.998

MIT Central Accessability