SMARCA4

Gene symbol:	SMARCA4
Gene:	6597
Uniprot Function:	Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Component of SWI/SNF chromatin remodeling complexes that carry out key enzymatic activities, changing chromatin structure by altering DNA-histone contacts within a nucleosome in an ATP-dependent manner. Component of the CREST-BRG1 complex, a multiprotein complex that regulates promoter activation by orchestrating the calcium-dependent release of a repressor complex and the recruitment of an activator complex. In resting neurons, transcription of the c-FOS promoter is inhibited by SMARCA4-dependent recruitment of a phospho-RB1-HDAC repressor complex. Upon calcium influx, RB1 is dephosphorylated by calcineurin, which leads to release of the repressor complex. At the same time, there is increased recruitment of CREBBP to the promoter by a CREST-dependent mechanism, which leads to transcriptional activation. The CREST-BRG1 complex also binds to the NR2B promoter, and activity-dependent induction of NR2B expression involves the release of HDAC1 and recruitment of CREBBP. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development, a switch from a stem/progenitor to a postmitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to postmitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth. SMARCA4/BAF190A may promote neural stem cell self-renewal/proliferation by enhancing Notch-dependent proliferative signals, while concurrently making the neural stem cell insensitive to SHH-dependent differentiating cues (By similarity). Acts as a corepressor of ZEB1 to regulate E-cadherin transcription and is required for induction of epithelial-mesenchymal transition (EMT) by ZEB1. Binds via DLX1 to enhancers located in the intergenic region between DLX5 and DLX6 and this binding is stabilized by the long non-coding RNA (lncRNA) Evf2 (By similarity). Binds to RNA in a promiscuous manner (By similarity). Binding to RNAs including lncRNA Evf2 leads to inhibition of SMARCA4 ATPase and chromatin remodeling activities (By similarity).
Mitotic Index	0.0255
Interphase Cluster:	#218 (7 genes)
Mitotic Cluster:	#50 (30 genes)
sgRNA 1:	ATGGTCCCTCTCGCAGCCCA (interphase cells: 1324, mitotic cells: 31)
sgRNA 2:	GCATGCTCAGAGCCACCCAG (interphase cells: 2088, mitotic cells: 46)
sgRNA 3:	GGGCGTACGAGTTTGACAAG (interphase cells: 1127, mitotic cells: 37)
sgRNA 4:	TGAACACCATCATGCAGCTG (interphase cells: 2718, mitotic cells: 76)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.027	1813 of 5322	0.738
Nucleus	DNA	Mean	-1.087e-01	4684 of 5322	0.005
Nucleus	gH2AX	Mean	0.008	4488 of 5322	0.861
Nucleus	DNA - gH2AX	Correlation	-1.431e-01	4685 of 5322	1.021e-04
Nucleus	Shape	Area	0.140	429 of 5322	0.004
Nucleus	Shape	Eccentricity	0.083	336 of 5322	0.016
Nucleus	Shape	Form Factor	0.001	608 of 5322	0.877
Nucleus	Shape	Solidity	0.021	247 of 5322	0.495
Cell	DNA	Mass Displacement	0.025	2681 of 5322	0.693
Cell	Tubulin	Mean	0.012	2295 of 5322	0.792
Cell	Tubulin	Mass Displacement	0.015	2098 of 5322	0.819
Cell	Actin	Mean	-1.015e-01	4934 of 5322	0.013
Cell	Tubulin - Actin	Correlation	-8.512e-02	5219 of 5322	0.016
Cell	DNA - Tubulin	Correlation	-2.308e-01	5304 of 5322	1.948e-04
Cell	Shape	Area	0.047	1625 of 5322	0.506
Cell	Shape	Eccentricity	0.013	2649 of 5322	0.890
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.151	1801 of 5322	0.922
Nucleus	DNA	Mean	0.135	1083 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.094	2003 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.076	1905 of 5322	1.000
Nucleus	gH2AX	Mean	0.144	1176 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.025	1889 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.105	1910 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.291	335 of 5322	0.814
Nucleus	Tubulin	Std Edge	0.175	615 of 5322	0.999
Nucleus	Shape	Area	0.172	1760 of 5322	0.934
Nucleus	Shape	Eccentricity	0.041	1490 of 5322	1.000
Nucleus	Shape	Form Factor	-1.690e-01	3799 of 5322	0.998
Cell	Tubulin	Mean	0.213	869 of 5322	0.975
Cell	Tubulin	Mean Frac 3	-3.083e-01	4749 of 5322	0.890
Cell	Actin	Mean	0.117	1649 of 5322	0.997
Cell	Shape	Area	0.188	1511 of 5322	0.994

MIT Central Accessability