RABL2B

Due to sgRNA sequence design constraints two or more of the sgRNAs used to target this gene have multiple genomic target sites, potentially impacting the observed phenotype through increased DNA damage.

Gene symbol:	RABL2B
Gene:	11158
Uniprot Function:	Small GTPase required for ciliation. Activated in a guanine nucleotide exchange factor (GEF)-independent manner via its intrinsic GDP for GTP nucleotide exchange ability (PubMed:28625565). Involved in ciliary assembly by binding the intraflagellar transport (IFT) complex B from the large pool pre-docked at the base of the cilium and thus triggers its entry into the cilia (PubMed:28625565, PubMed:28428259).
Mitotic Index	0.027000000000000003
Interphase Cluster:	#79 (26 genes)
Mitotic Cluster:	#18 (40 genes)
sgRNA 1:	AACCGAGTGAGTTGGACCAA (interphase cells: 743, mitotic cells: 23)
sgRNA 2:	GATGGTCCTTCCATCTACCG (interphase cells: 953, mitotic cells: 28)
sgRNA 3:	GCATGCCTCCTACTACCACA (interphase cells: 1834, mitotic cells: 55)
sgRNA 4:	TGCAGGTGTTTGATGTACAG (interphase cells: 2353, mitotic cells: 57)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	-2.561e-02	4247 of 5322	0.678
Nucleus	DNA	Mean	-7.608e-02	4212 of 5322	0.076
Nucleus	gH2AX	Mean	0.029	4052 of 5322	0.463
Nucleus	DNA - gH2AX	Correlation	-9.792e-02	3924 of 5322	0.001
Nucleus	Shape	Area	0.016	2736 of 5322	0.890
Nucleus	Shape	Eccentricity	0.019	2274 of 5322	0.671
Nucleus	Shape	Form Factor	-1.429e-02	1040 of 5322	0.792
Nucleus	Shape	Solidity	-6.542e-02	3340 of 5322	0.060
Cell	DNA	Mass Displacement	0.018	3197 of 5322	0.827
Cell	Tubulin	Mean	-4.703e-02	4246 of 5322	0.346
Cell	Tubulin	Mass Displacement	0.037	971 of 5322	0.468
Cell	Actin	Mean	-3.511e-02	4037 of 5322	0.533
Cell	Tubulin - Actin	Correlation	0.018	2737 of 5322	0.734
Cell	DNA - Tubulin	Correlation	0.046	2031 of 5322	0.246
Cell	Shape	Area	0.001	3195 of 5322	0.931
Cell	Shape	Eccentricity	0.040	917 of 5322	0.529
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.133	2027 of 5322	0.949
Nucleus	DNA	Mean	-4.019e-02	3580 of 5322	1.000
Nucleus	DNA	Mass Displacement	-1.327e-01	4934 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.168	843 of 5322	1.000
Nucleus	gH2AX	Mean	-1.981e-02	3218 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.001	2255 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.176	1051 of 5322	0.999
Nucleus	Tubulin	Mean Edge	-4.088e-02	3705 of 5322	0.999
Nucleus	Tubulin	Std Edge	-1.062e-01	3957 of 5322	0.999
Nucleus	Shape	Area	0.023	3701 of 5322	0.990
Nucleus	Shape	Eccentricity	-1.668e-01	4276 of 5322	1.000
Nucleus	Shape	Form Factor	-1.129e-01	3038 of 5322	0.998
Cell	Tubulin	Mean	0.092	2154 of 5322	0.997
Cell	Tubulin	Mean Frac 3	-9.536e-02	2883 of 5322	0.999
Cell	Actin	Mean	0.211	826 of 5322	0.997
Cell	Shape	Area	-5.819e-02	4495 of 5322	0.998

MIT Central Accessability