PLEC

Gene symbol:	PLEC
Gene:	5339
Uniprot Function:	Interlinks intermediate filaments with microtubules and microfilaments and anchors intermediate filaments to desmosomes or hemidesmosomes. Could also bind muscle proteins such as actin to membrane complexes in muscle. May be involved not only in the filaments network, but also in the regulation of their dynamics. Structural component of muscle. Isoform 9 plays a major role in the maintenance of myofiber integrity.
Mitotic Index	0.0235
Interphase Cluster:	#89 (25 genes)
Mitotic Cluster:	#140 (20 genes)
sgRNA 1:	CACCTGCTTATAGTCGCACA (interphase cells: 1525, mitotic cells: 38)
sgRNA 2:	CCGTGCGAGCTCGTCCACCG (interphase cells: 280, mitotic cells: 5)
sgRNA 3:	TATGAGGTGCTCTTCCGCGA (interphase cells: 718, mitotic cells: 14)
sgRNA 4:	TCGAAACGATACCTTCAGAG (interphase cells: 1956, mitotic cells: 51)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.014	2426 of 5322	0.911
Nucleus	DNA	Mean	-4.739e-02	3516 of 5322	0.359
Nucleus	gH2AX	Mean	0.054	3377 of 5322	0.220
Nucleus	DNA - gH2AX	Correlation	-1.911e-02	1382 of 5322	0.569
Nucleus	Shape	Area	0.084	920 of 5322	0.155
Nucleus	Shape	Eccentricity	0.109	152 of 5322	0.006
Nucleus	Shape	Form Factor	-1.047e-01	4471 of 5322	0.020
Nucleus	Shape	Solidity	-6.580e-02	3356 of 5322	0.096
Cell	DNA	Mass Displacement	0.036	1879 of 5322	0.633
Cell	Tubulin	Mean	0.003	2668 of 5322	0.942
Cell	Tubulin	Mass Displacement	0.024	1601 of 5322	0.757
Cell	Actin	Mean	0.021	2310 of 5322	0.743
Cell	Tubulin - Actin	Correlation	-1.162e-02	4169 of 5322	0.866
Cell	DNA - Tubulin	Correlation	0.006	3609 of 5322	0.935
Cell	Shape	Area	0.095	654 of 5322	0.107
Cell	Shape	Eccentricity	0.016	2393 of 5322	0.891
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.078	2802 of 5322	0.979
Nucleus	DNA	Mean	0.096	1513 of 5322	1.000
Nucleus	DNA	Mass Displacement	-1.760e-01	5125 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.123	1286 of 5322	1.000
Nucleus	gH2AX	Mean	0.123	1366 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.141	651 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.052	2707 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.067	2294 of 5322	0.999
Nucleus	Tubulin	Std Edge	0.054	1819 of 5322	0.999
Nucleus	Shape	Area	0.082	2909 of 5322	0.990
Nucleus	Shape	Eccentricity	-3.327e-02	2618 of 5322	1.000
Nucleus	Shape	Form Factor	-7.997e-02	2563 of 5322	0.998
Cell	Tubulin	Mean	0.074	2438 of 5322	0.997
Cell	Tubulin	Mean Frac 3	-3.987e-02	2161 of 5322	0.999
Cell	Actin	Mean	0.040	2651 of 5322	0.997
Cell	Shape	Area	0.340	519 of 5322	0.925

MIT Central Accessability