NUP153

Gene symbol:	NUP153
Gene:	9972
Uniprot Function:	Component of the nuclear pore complex (NPC), a complex required for the trafficking across the nuclear envelope. Functions as a scaffolding element in the nuclear phase of the NPC essential for normal nucleocytoplasmic transport of proteins and mRNAs. Involved in the quality control and retention of unspliced mRNAs in the nucleus; in association with TPR, regulates the nuclear export of unspliced mRNA species bearing constitutive transport element (CTE) in a NXF1- and KHDRBS1-independent manner. Mediates TPR anchoring to the nuclear membrane at NPC. The repeat-containing domain may be involved in anchoring other components of the NPC to the pore membrane. Possible DNA-binding subunit of the nuclear pore complex (NPC).
Mitotic Index	0.0219
Interphase Cluster:	#115 (22 genes)
Mitotic Cluster:	#18 (40 genes)
sgRNA 1:	ACACAAGCGAGGTTCCACGC (interphase cells: 696, mitotic cells: 21)
sgRNA 2:	GATAACATCTCAACTACCAG (interphase cells: 2649, mitotic cells: 55)
sgRNA 3:	GCGAGCCCTTACATTGACAG (interphase cells: 2560, mitotic cells: 59)
sgRNA 4:	GGAAAAGTTCAAGAAACCCG (interphase cells: 659, mitotic cells: 12)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	-3.979e-02	4666 of 5322	0.467
Nucleus	DNA	Mean	0.091	539 of 5322	0.024
Nucleus	gH2AX	Mean	0.012	4412 of 5322	0.782
Nucleus	DNA - gH2AX	Correlation	0.011	737 of 5322	0.813
Nucleus	Shape	Area	-1.809e-01	5021 of 5322	1.633e-04
Nucleus	Shape	Eccentricity	-6.000e-02	4913 of 5322	0.129
Nucleus	Shape	Form Factor	-3.453e-02	1930 of 5322	0.422
Nucleus	Shape	Solidity	-7.017e-02	3504 of 5322	0.046
Cell	DNA	Mass Displacement	0.013	3542 of 5322	0.879
Cell	Tubulin	Mean	-4.159e-02	4114 of 5322	0.422
Cell	Tubulin	Mass Displacement	-8.004e-02	5046 of 5322	0.030
Cell	Actin	Mean	-2.884e-02	3881 of 5322	0.647
Cell	Tubulin - Actin	Correlation	-2.435e-02	4615 of 5322	0.637
Cell	DNA - Tubulin	Correlation	-3.250e-02	4743 of 5322	0.432
Cell	Shape	Area	-9.598e-02	4777 of 5322	0.019
Cell	Shape	Eccentricity	0.040	940 of 5322	0.538
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.058	3126 of 5322	0.984
Nucleus	DNA	Mean	0.026	2536 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.067	2435 of 5322	0.999
Nucleus	DNA	Mean Frac 3	-4.791e-02	3812 of 5322	1.000
Nucleus	gH2AX	Mean	-1.251e-01	4451 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.011	2099 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.052	2714 of 5322	0.999
Nucleus	Tubulin	Mean Edge	-1.107e-02	3331 of 5322	0.999
Nucleus	Tubulin	Std Edge	0.003	2520 of 5322	0.999
Nucleus	Shape	Area	0.083	2891 of 5322	0.990
Nucleus	Shape	Eccentricity	-1.253e-01	3884 of 5322	1.000
Nucleus	Shape	Form Factor	-2.348e-02	1698 of 5322	0.998
Cell	Tubulin	Mean	0.246	672 of 5322	0.975
Cell	Tubulin	Mean Frac 3	-2.206e-01	4236 of 5322	0.999
Cell	Actin	Mean	0.209	832 of 5322	0.997
Cell	Shape	Area	0.034	3477 of 5322	0.999

MIT Central Accessability