KRTAP10-4

Due to sgRNA sequence design constraints two or more of the sgRNAs used to target this gene have multiple genomic target sites, potentially impacting the observed phenotype through increased DNA damage.

Gene symbol:	KRTAP10-4
Gene:	386672
Uniprot Function:	In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.
Mitotic Index	0.0265
Interphase Cluster:	#7 (45 genes)
Mitotic Cluster:	#116 (23 genes)
sgRNA 1:	CAGACAGGCTTGCAGCAGAT (interphase cells: 1105, mitotic cells: 28)
sgRNA 2:	CTGCAAGCCTGTGTGCTCTG (interphase cells: 1928, mitotic cells: 59)
sgRNA 3:	GAAGAATCCCCACAGCAGAC (interphase cells: 2850, mitotic cells: 82)
sgRNA 4:	GAGGAATCCTCAGAGCACAC (interphase cells: 1614, mitotic cells: 35)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.002	3032 of 5322	0.993
Nucleus	DNA	Mean	0.006	1789 of 5322	0.870
Nucleus	gH2AX	Mean	0.003	4559 of 5322	0.957
Nucleus	DNA - gH2AX	Correlation	0.021	607 of 5322	0.574
Nucleus	Shape	Area	0.053	1599 of 5322	0.364
Nucleus	Shape	Eccentricity	0.017	2376 of 5322	0.677
Nucleus	Shape	Form Factor	3.019e-04	635 of 5322	0.902
Nucleus	Shape	Solidity	0.016	311 of 5322	0.604
Cell	DNA	Mass Displacement	0.020	3047 of 5322	0.778
Cell	Tubulin	Mean	-1.725e-02	3444 of 5322	0.790
Cell	Tubulin	Mass Displacement	-1.204e-02	3676 of 5322	0.872
Cell	Actin	Mean	-1.548e-02	3505 of 5322	0.831
Cell	Tubulin - Actin	Correlation	0.019	2706 of 5322	0.684
Cell	DNA - Tubulin	Correlation	0.038	2316 of 5322	0.304
Cell	Shape	Area	0.043	1746 of 5322	0.559
Cell	Shape	Eccentricity	0.005	3312 of 5322	0.969
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.094	2578 of 5322	0.965
Nucleus	DNA	Mean	0.278	284 of 5322	1.000
Nucleus	DNA	Mass Displacement	-1.247e-01	4879 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.105	1503 of 5322	1.000
Nucleus	gH2AX	Mean	0.072	1938 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.066	1339 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.065	2494 of 5322	0.999
Nucleus	Tubulin	Mean Edge	-1.696e-02	3411 of 5322	0.999
Nucleus	Tubulin	Std Edge	0.206	444 of 5322	0.999
Nucleus	Shape	Area	-7.988e-02	4683 of 5322	0.989
Nucleus	Shape	Eccentricity	0.044	1442 of 5322	1.000
Nucleus	Shape	Form Factor	0.076	568 of 5322	0.998
Cell	Tubulin	Mean	-3.996e-02	4013 of 5322	0.997
Cell	Tubulin	Mean Frac 3	-2.935e-01	4693 of 5322	0.919
Cell	Actin	Mean	-3.695e-02	3730 of 5322	0.997
Cell	Shape	Area	0.134	2164 of 5322	0.998

MIT Central Accessability