HUS1

Gene symbol:	HUS1
Gene:	3364
Uniprot Function:	Component of the 9-1-1 cell-cycle checkpoint response complex that plays a major role in DNA repair. The 9-1-1 complex is recruited to DNA lesion upon damage by the RAD17-replication factor C (RFC) clamp loader complex. Acts then as a sliding clamp platform on DNA for several proteins involved in long-patch base excision repair (LP-BER). The 9-1-1 complex stimulates DNA polymerase beta (POLB) activity by increasing its affinity for the 3'-OH end of the primer-template and stabilizes POLB to those sites where LP-BER proceeds; endonuclease FEN1 cleavage activity on substrates with double, nick, or gap flaps of distinct sequences and lengths; and DNA ligase I (LIG1) on long-patch base excision repair substrates. The 9-1-1 complex is necessary for the recruitment of RHNO1 to sites of double-stranded breaks (DSB) occurring during the S phase.
Mitotic Index	0.0279
Interphase Cluster:	#6 (46 genes)
Mitotic Cluster:	#116 (23 genes)
sgRNA 1:	GAAGGACTTACAAGAACCGG (interphase cells: 2331, mitotic cells: 64)
sgRNA 2:	GATTTATTTAGAGCTAACAT (interphase cells: 1528, mitotic cells: 35)
sgRNA 3:	TCGGGCCAAGATCGTGGACG (interphase cells: 1589, mitotic cells: 39)
sgRNA 4:	TGTGACAAGCTGGCTAATGG (interphase cells: 2768, mitotic cells: 98)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.044	1191 of 5322	0.481
Nucleus	DNA	Mean	0.063	700 of 5322	0.092
Nucleus	gH2AX	Mean	0.165	833 of 5322	4.462e-04
Nucleus	DNA - gH2AX	Correlation	-3.588e-02	1901 of 5322	0.178
Nucleus	Shape	Area	-7.149e-02	4677 of 5322	0.055
Nucleus	Shape	Eccentricity	-4.165e-02	4723 of 5322	0.272
Nucleus	Shape	Form Factor	-3.934e-03	725 of 5322	0.995
Nucleus	Shape	Solidity	-2.594e-02	1566 of 5322	0.439
Cell	DNA	Mass Displacement	0.013	3579 of 5322	0.869
Cell	Tubulin	Mean	0.111	417 of 5322	0.002
Cell	Tubulin	Mass Displacement	-1.620e-02	3875 of 5322	0.806
Cell	Actin	Mean	0.065	1276 of 5322	0.155
Cell	Tubulin - Actin	Correlation	0.026	2383 of 5322	0.547
Cell	DNA - Tubulin	Correlation	0.036	2401 of 5322	0.342
Cell	Shape	Area	-6.323e-02	4549 of 5322	0.105
Cell	Shape	Eccentricity	0.022	1978 of 5322	0.755
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.151	1803 of 5322	0.909
Nucleus	DNA	Mean	0.067	1924 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.181	928 of 5322	0.999
Nucleus	DNA	Mean Frac 3	-5.203e-03	3203 of 5322	1.000
Nucleus	gH2AX	Mean	0.288	373 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.035	1757 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.103	1943 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.145	1309 of 5322	0.996
Nucleus	Tubulin	Std Edge	-4.986e-02	3263 of 5322	0.999
Nucleus	Shape	Area	0.053	3302 of 5322	0.990
Nucleus	Shape	Eccentricity	0.136	552 of 5322	1.000
Nucleus	Shape	Form Factor	-1.264e-02	1572 of 5322	0.998
Cell	Tubulin	Mean	0.168	1252 of 5322	0.997
Cell	Tubulin	Mean Frac 3	-2.393e-01	4360 of 5322	0.999
Cell	Actin	Mean	-1.387e-01	4722 of 5322	0.997
Cell	Shape	Area	0.101	2592 of 5322	0.998

MIT Central Accessability