HDAC4

Gene symbol:	HDAC4
Gene:	9759
Uniprot Function:	Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. Involved in muscle maturation via its interaction with the myocyte enhancer factors such as MEF2A, MEF2C and MEF2D. Involved in the MTA1-mediated epigenetic regulation of ESR1 expression in breast cancer. Deacetylates HSPA1A and HSPA1B at 'Lys-77' leading to their preferential binding to co-chaperone STUB1 (PubMed:27708256).
Mitotic Index	0.0237
Interphase Cluster:	#219 (7 genes)
Mitotic Cluster:	#158 (17 genes)
sgRNA 1:	CTTACCCGTACCAGTAGCGA (interphase cells: 987, mitotic cells: 33)
sgRNA 2:	GGGGCTGACTTACCGCAGAG (interphase cells: 1307, mitotic cells: 24)
sgRNA 3:	TGCAGTGGTTCAGATTCCGG (interphase cells: 2172, mitotic cells: 47)
sgRNA 4:	TTCTGGCCGAGACCAGCCAG (interphase cells: 734, mitotic cells: 22)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	-3.228e-02	4466 of 5322	0.597
Nucleus	DNA	Mean	-8.177e-02	4324 of 5322	0.056
Nucleus	gH2AX	Mean	0.099	1983 of 5322	0.019
Nucleus	DNA - gH2AX	Correlation	-7.682e-02	3326 of 5322	0.012
Nucleus	Shape	Area	0.003	3191 of 5322	0.962
Nucleus	Shape	Eccentricity	0.023	2086 of 5322	0.620
Nucleus	Shape	Form Factor	-2.427e-02	1470 of 5322	0.612
Nucleus	Shape	Solidity	-3.429e-02	1957 of 5322	0.352
Cell	DNA	Mass Displacement	-8.003e-03	4724 of 5322	0.878
Cell	Tubulin	Mean	0.015	2162 of 5322	0.754
Cell	Tubulin	Mass Displacement	0.065	401 of 5322	0.105
Cell	Actin	Mean	0.016	2480 of 5322	0.790
Cell	Tubulin - Actin	Correlation	-2.734e-03	3800 of 5322	0.969
Cell	DNA - Tubulin	Correlation	-4.808e-02	4937 of 5322	0.212
Cell	Shape	Area	-2.499e-02	3926 of 5322	0.580
Cell	Shape	Eccentricity	0.028	1577 of 5322	0.727
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.168	1602 of 5322	0.921
Nucleus	DNA	Mean	-2.618e-02	3376 of 5322	1.000
Nucleus	DNA	Mass Displacement	-7.175e-02	4428 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.182	735 of 5322	1.000
Nucleus	gH2AX	Mean	0.107	1533 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	-1.893e-01	4725 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.189	951 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.123	1573 of 5322	0.999
Nucleus	Tubulin	Std Edge	-2.203e-01	4718 of 5322	0.999
Nucleus	Shape	Area	0.072	3031 of 5322	0.990
Nucleus	Shape	Eccentricity	-2.945e-01	4946 of 5322	1.000
Nucleus	Shape	Form Factor	-1.047e-01	2918 of 5322	0.998
Cell	Tubulin	Mean	0.001	3489 of 5322	1.000
Cell	Tubulin	Mean Frac 3	-5.231e-02	2344 of 5322	0.999
Cell	Actin	Mean	-1.064e-01	4479 of 5322	0.997
Cell	Shape	Area	0.169	1729 of 5322	0.998

MIT Central Accessability