ELOVL1

Gene symbol:	ELOVL1
Gene:	64834
Uniprot Function:	Catalyzes the first and rate-limiting reaction of the four reactions that constitute the long-chain fatty acids elongation cycle (PubMed:29496980, PubMed:30487246). This endoplasmic reticulum-bound enzymatic process allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids (VLCFAs) per cycle. Condensing enzyme that exhibits activity toward saturated and monounsaturated acyl-CoA substrates, with the highest activity towards C22:0 acyl-CoA. May participate in the production of both saturated and monounsaturated VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators. Important for saturated C24:0 and monounsaturated C24:1 sphingolipid synthesis (PubMed:20937905). Indirectly inhibits RPE65 via production of VLCFAs.
Mitotic Index	0.021
Interphase Cluster:	#104 (23 genes)
Mitotic Cluster:	#95 (24 genes)
sgRNA 1:	AAAGGTAGGGTTGTGCCACA (interphase cells: 1025, mitotic cells: 19)
sgRNA 2:	CAAGAGGTGATGAAGCACGC (interphase cells: 942, mitotic cells: 24)
sgRNA 3:	CAGGTACATTATGACATGCA (interphase cells: 2276, mitotic cells: 49)
sgRNA 4:	TGAGAGAACGAAGTACACGT (interphase cells: 1175, mitotic cells: 24)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.016	2345 of 5322	0.884
Nucleus	DNA	Mean	-1.132e-02	2338 of 5322	0.865
Nucleus	gH2AX	Mean	0.021	4239 of 5322	0.609
Nucleus	DNA - gH2AX	Correlation	0.056	322 of 5322	0.107
Nucleus	Shape	Area	0.022	2530 of 5322	0.811
Nucleus	Shape	Eccentricity	-6.461e-02	4946 of 5322	0.097
Nucleus	Shape	Form Factor	-2.484e-03	688 of 5322	0.966
Nucleus	Shape	Solidity	-4.063e-03	757 of 5322	0.940
Cell	DNA	Mass Displacement	0.005	4104 of 5322	0.986
Cell	Tubulin	Mean	-1.605e-02	3407 of 5322	0.826
Cell	Tubulin	Mass Displacement	0.040	883 of 5322	0.426
Cell	Actin	Mean	-1.698e-02	3549 of 5322	0.813
Cell	Tubulin - Actin	Correlation	0.005	3471 of 5322	0.936
Cell	DNA - Tubulin	Correlation	-1.175e-01	5229 of 5322	0.002
Cell	Shape	Area	0.035	1987 of 5322	0.695
Cell	Shape	Eccentricity	-2.971e-02	4984 of 5322	0.728
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.096	2548 of 5322	0.979
Nucleus	DNA	Mean	0.097	1504 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.025	3123 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.109	1459 of 5322	1.000
Nucleus	gH2AX	Mean	0.259	475 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	0.105	924 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.315	290 of 5322	0.999
Nucleus	Tubulin	Mean Edge	-3.183e-02	3600 of 5322	0.999
Nucleus	Tubulin	Std Edge	-9.869e-02	3881 of 5322	0.999
Nucleus	Shape	Area	0.228	1240 of 5322	0.951
Nucleus	Shape	Eccentricity	-1.260e-01	3891 of 5322	1.000
Nucleus	Shape	Form Factor	0.154	200 of 5322	0.998
Cell	Tubulin	Mean	0.055	2715 of 5322	0.997
Cell	Tubulin	Mean Frac 3	-1.299e-01	3301 of 5322	0.999
Cell	Actin	Mean	-1.629e-01	4878 of 5322	0.997
Cell	Shape	Area	0.322	579 of 5322	0.994

MIT Central Accessability