EIF3C

Due to sgRNA sequence design constraints two or more of the sgRNAs used to target this gene have multiple genomic target sites, potentially impacting the observed phenotype through increased DNA damage.

Gene symbol:	EIF3C
Gene:	8663
Uniprot Function:	Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis (PubMed:17581632, PubMed:25849773, PubMed:27462815). The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation (PubMed:17581632). The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression (PubMed:25849773).
Mitotic Index	0.0237
Interphase Cluster:	#46 (31 genes)
Mitotic Cluster:	#18 (40 genes)
sgRNA 1:	AACGAGGGCTACATGCGCCG (interphase cells: 463, mitotic cells: 10)
sgRNA 2:	ATTGCAGCGGAAAACAACCT (interphase cells: 598, mitotic cells: 11)
sgRNA 3:	CGGGTGTTTGACCACAAGCA (interphase cells: 1212, mitotic cells: 34)
sgRNA 4:	TGATATGGGACTCGAAATCA (interphase cells: 737, mitotic cells: 18)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.156	226 of 5322	0.009
Nucleus	DNA	Mean	0.442	143 of 5322	1.505e-04
Nucleus	gH2AX	Mean	0.243	417 of 5322	2.456e-04
Nucleus	DNA - gH2AX	Correlation	0.195	67 of 5322	1.021e-04
Nucleus	Shape	Area	-2.482e-01	5080 of 5322	1.633e-04
Nucleus	Shape	Eccentricity	-3.985e-02	4692 of 5322	0.485
Nucleus	Shape	Form Factor	0.026	223 of 5322	0.475
Nucleus	Shape	Solidity	-6.155e-02	3188 of 5322	0.141
Cell	DNA	Mass Displacement	4.121e-05	4358 of 5322	0.976
Cell	Tubulin	Mean	0.113	406 of 5322	0.012
Cell	Tubulin	Mass Displacement	-3.924e-03	3258 of 5322	0.980
Cell	Actin	Mean	0.197	293 of 5322	3.322e-04
Cell	Tubulin - Actin	Correlation	0.044	1629 of 5322	0.422
Cell	DNA - Tubulin	Correlation	0.083	1189 of 5322	0.055
Cell	Shape	Area	-2.260e-01	5054 of 5322	1.651e-04
Cell	Shape	Eccentricity	0.032	1336 of 5322	0.748
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.017	3702 of 5322	0.996
Nucleus	DNA	Mean	0.038	2344 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.266	389 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.220	485 of 5322	1.000
Nucleus	gH2AX	Mean	-3.944e-02	3498 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	-8.697e-02	3625 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	-1.709e-01	5059 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.355	171 of 5322	0.889
Nucleus	Tubulin	Std Edge	-6.499e-02	3463 of 5322	0.999
Nucleus	Shape	Area	0.031	3598 of 5322	0.990
Nucleus	Shape	Eccentricity	-1.089e-01	3688 of 5322	1.000
Nucleus	Shape	Form Factor	-1.431e-01	3487 of 5322	0.998
Cell	Tubulin	Mean	0.227	774 of 5322	0.997
Cell	Tubulin	Mean Frac 3	0.105	698 of 5322	0.999
Cell	Actin	Mean	0.213	811 of 5322	0.997
Cell	Shape	Area	-1.310e-01	4954 of 5322	0.998

MIT Central Accessability