ABL1

Gene symbol:	ABL1
Gene:	25
Uniprot Function:	Non-receptor tyrosine-protein kinase that plays a role in many key processes linked to cell growth and survival such as cytoskeleton remodeling in response to extracellular stimuli, cell motility and adhesion, receptor endocytosis, autophagy, DNA damage response and apoptosis. Coordinates actin remodeling through tyrosine phosphorylation of proteins controlling cytoskeleton dynamics like WASF3 (involved in branch formation); ANXA1 (involved in membrane anchoring); DBN1, DBNL, CTTN, RAPH1 and ENAH (involved in signaling); or MAPT and PXN (microtubule-binding proteins). Phosphorylation of WASF3 is critical for the stimulation of lamellipodia formation and cell migration. Involved in the regulation of cell adhesion and motility through phosphorylation of key regulators of these processes such as BCAR1, CRK, CRKL, DOK1, EFS or NEDD9. Phosphorylates multiple receptor tyrosine kinases and more particularly promotes endocytosis of EGFR, facilitates the formation of neuromuscular synapses through MUSK, inhibits PDGFRB-mediated chemotaxis and modulates the endocytosis of activated B-cell receptor complexes. Other substrates which are involved in endocytosis regulation are the caveolin (CAV1) and RIN1. Moreover, ABL1 regulates the CBL family of ubiquitin ligases that drive receptor down-regulation and actin remodeling. Phosphorylation of CBL leads to increased EGFR stability. Involved in late-stage autophagy by regulating positively the trafficking and function of lysosomal components. ABL1 targets to mitochondria in response to oxidative stress and thereby mediates mitochondrial dysfunction and cell death. In response to oxidative stress, phosphorylates serine/threonine kinase PRKD2 at 'Tyr-717' (PubMed:28428613). ABL1 is also translocated in the nucleus where it has DNA-binding activity and is involved in DNA-damage response and apoptosis. Many substrates are known mediators of DNA repair: DDB1, DDB2, ERCC3, ERCC6, RAD9A, RAD51, RAD52 or WRN. Activates the proapoptotic pathway when the DNA damage is too severe to be repaired. Phosphorylates TP73, a primary regulator for this type of damage-induced apoptosis. Phosphorylates the caspase CASP9 on 'Tyr-153' and regulates its processing in the apoptotic response to DNA damage. Phosphorylates PSMA7 that leads to an inhibition of proteasomal activity and cell cycle transition blocks. ABL1 acts also as a regulator of multiple pathological signaling cascades during infection. Several known tyrosine-phosphorylated microbial proteins have been identified as ABL1 substrates. This is the case of A36R of Vaccinia virus, Tir (translocated intimin receptor) of pathogenic E.coli and possibly Citrobacter, CagA (cytotoxin-associated gene A) of H.pylori, or AnkA (ankyrin repeat-containing protein A) of A.phagocytophilum. Pathogens can highjack ABL1 kinase signaling to reorganize the host actin cytoskeleton for multiple purposes, like facilitating intracellular movement and host cell exit. Finally, functions as its own regulator through autocatalytic activity as well as through phosphorylation of its inhibitor, ABI1. Regulates T-cell differentiation in a TBX21-dependent manner. Phosphorylates TBX21 on tyrosine residues leading to an enhancement of its transcriptional activator activity (By similarity).
Mitotic Index	0.0236
Interphase Cluster:	#168 (16 genes)
Mitotic Cluster:	#137 (20 genes)
sgRNA 1:	CAAGAACTCTTCCACCTCCA (interphase cells: 2456, mitotic cells: 56)
sgRNA 2:	GGTTCATCATCATTCAACGG (interphase cells: 2184, mitotic cells: 49)
sgRNA 3:	TGGGCTGCAAATCCAAGAAG (interphase cells: 2104, mitotic cells: 60)
sgRNA 4:	TTGCTCCCTCGAAAAGAGCG (interphase cells: 1233, mitotic cells: 28)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.039	1343 of 5322	0.553
Nucleus	DNA	Mean	0.041	950 of 5322	0.291
Nucleus	gH2AX	Mean	0.158	913 of 5322	4.462e-04
Nucleus	DNA - gH2AX	Correlation	-4.970e-02	2401 of 5322	0.062
Nucleus	Shape	Area	0.023	2523 of 5322	0.790
Nucleus	Shape	Eccentricity	0.004	3080 of 5322	0.901
Nucleus	Shape	Form Factor	0.022	264 of 5322	0.419
Nucleus	Shape	Solidity	0.009	444 of 5322	0.770
Cell	DNA	Mass Displacement	0.035	1927 of 5322	0.535
Cell	Tubulin	Mean	0.038	1431 of 5322	0.348
Cell	Tubulin	Mass Displacement	0.034	1103 of 5322	0.459
Cell	Actin	Mean	0.055	1460 of 5322	0.240
Cell	Tubulin - Actin	Correlation	0.026	2370 of 5322	0.547
Cell	DNA - Tubulin	Correlation	-8.355e-03	4117 of 5322	0.847
Cell	Shape	Area	0.027	2265 of 5322	0.797
Cell	Shape	Eccentricity	0.014	2601 of 5322	0.876
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.088	2662 of 5322	0.965
Nucleus	DNA	Mean	0.015	2689 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.050	2691 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.079	1862 of 5322	1.000
Nucleus	gH2AX	Mean	0.116	1439 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	-5.867e-02	3210 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.013	3290 of 5322	0.999
Nucleus	Tubulin	Mean Edge	-9.475e-02	4294 of 5322	0.999
Nucleus	Tubulin	Std Edge	-2.663e-02	2923 of 5322	0.999
Nucleus	Shape	Area	0.060	3195 of 5322	0.990
Nucleus	Shape	Eccentricity	-8.167e-02	3328 of 5322	1.000
Nucleus	Shape	Form Factor	-1.854e-01	3996 of 5322	0.998
Cell	Tubulin	Mean	0.118	1813 of 5322	0.997
Cell	Tubulin	Mean Frac 3	-1.642e-01	3684 of 5322	0.999
Cell	Actin	Mean	-1.736e-02	3439 of 5322	0.998
Cell	Shape	Area	0.129	2218 of 5322	0.998

MIT Central Accessability