ABCB10

Gene symbol:	ABCB10
Gene:	23456
Uniprot Function:	Catalyzes the export of an unknown physiological substrate from the mitochondrial matrix to the cytosol in an ATP-dependent manner (PubMed:33253225). May also transport the heme analog Zn (II) mesoporphyrin (ZnMP) in an ATP dependent manner but can't export the heme precursor 5-aminolevulinic acid (ALA) from mitochondria (PubMed:33253225). Plays a role in the early step of the heme biosynthetic process during insertion of iron into protoporphyrin IX (PPIX). In turn participates in hemoglobin synthesis and also protects against oxidative stress (PubMed:28808058, PubMed:22085049). In addition may be involved in mitochondrial unfolded protein response (UPRmt) signaling pathway, although ABCB10 probably does not participate in peptide export from mitochondria (PubMed:28315685).
Mitotic Index	0.0264
Interphase Cluster:	#96 (24 genes)
Mitotic Cluster:	#137 (20 genes)
sgRNA 1:	ACAGCAATGATTGACACTGG (interphase cells: 2704, mitotic cells: 65)
sgRNA 2:	CTCAGTGCCGTGTTTCTGTG (interphase cells: 3210, mitotic cells: 109)
sgRNA 3:	GAGTTCACCCACGGTCATGT (interphase cells: 1599, mitotic cells: 34)
sgRNA 4:	TATCGCCGTTCACTGGCCTG (interphase cells: 2288, mitotic cells: 58)

External Links

Interphase Cluster

Mitotic Cluster

Each montage below shows randomly selected individual cell images for the same target gene separated by sgRNA, along with an example montage of cells expressing a non-targeting negative control sgRNA at the bottom. sgRNA labels in the montages correspond to the numbered sgRNA sequences in the gene info table above. The DNA (blue) and tubulin (green) channels are displayed by default, with gH2AX (grayscale) and actin (yellow) available using the check boxes. Channel brightness, contrast, and opacity are adjustable by clicking the arrow next to the channel name. When only one channel is selected, the display defaults to grayscale. Click the “Zoom” checkbox above the channel controls to enable image zooming (via scrolling) and panning (via click-and-drag).

The cell boxes displayed for this gene are square, 30.36 μm per side for the interphase montage and 30.36 μm per side for the mitotic montage.

Features

Interphase			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	0.032	1625 of 5322	0.645
Nucleus	DNA	Mean	0.016	1493 of 5322	0.674
Nucleus	gH2AX	Mean	0.070	2853 of 5322	0.055
Nucleus	DNA - gH2AX	Correlation	-7.252e-02	3198 of 5322	0.006
Nucleus	Shape	Area	-2.792e-02	4080 of 5322	0.480
Nucleus	Shape	Eccentricity	0.007	2933 of 5322	0.852
Nucleus	Shape	Form Factor	-2.410e-02	1458 of 5322	0.548
Nucleus	Shape	Solidity	-1.552e-02	1129 of 5322	0.649
Cell	DNA	Mass Displacement	0.019	3113 of 5322	0.761
Cell	Tubulin	Mean	0.010	2371 of 5322	0.800
Cell	Tubulin	Mass Displacement	0.034	1084 of 5322	0.412
Cell	Actin	Mean	0.021	2299 of 5322	0.687
Cell	Tubulin - Actin	Correlation	-1.201e-02	4183 of 5322	0.805
Cell	DNA - Tubulin	Correlation	-1.050e-02	4184 of 5322	0.803
Cell	Shape	Area	-1.235e-02	3581 of 5322	0.725
Cell	Shape	Eccentricity	0.002	3571 of 5322	0.982
Mitotic			Score	Rank	FDR q-value
Nucleus	DNA	Integrated	-2.503e-02	4225 of 5322	0.991
Nucleus	DNA	Mean	0.096	1511 of 5322	1.000
Nucleus	DNA	Mass Displacement	0.060	2530 of 5322	0.999
Nucleus	DNA	Mean Frac 3	0.031	2635 of 5322	1.000
Nucleus	gH2AX	Mean	0.200	748 of 5322	1.000
Nucleus	gH2AX	Mean Frac 0	-1.542e-01	4428 of 5322	1.000
Nucleus	Tubulin	Mean Frac 0	0.087	2152 of 5322	0.999
Nucleus	Tubulin	Mean Edge	0.157	1194 of 5322	0.996
Nucleus	Tubulin	Std Edge	0.014	2362 of 5322	0.999
Nucleus	Shape	Area	0.164	1851 of 5322	0.929
Nucleus	Shape	Eccentricity	0.061	1238 of 5322	1.000
Nucleus	Shape	Form Factor	-1.030e-01	2902 of 5322	0.998
Cell	Tubulin	Mean	0.247	670 of 5322	0.896
Cell	Tubulin	Mean Frac 3	-1.395e-01	3420 of 5322	0.999
Cell	Actin	Mean	0.172	1094 of 5322	0.997
Cell	Shape	Area	0.074	2947 of 5322	0.998

MIT Central Accessability